Association of aldosterone synthase CYP11B2 (-344C/T) gene polymorphism with essential hypertension and left ventricular hypertrophy in the Egyptian population

Background and Objectives: Essential hypertension is a complex progressive cardiovascular disorder. Renin–angiotensin aldosterone system (RAAS) plays a major role in blood pressure regulation. Aldosterone, synthesized in the adrenal cortex by aldosterone synthase is encoded by the CYP11B2 gene. This case-control study was aiming to investigate the relationship between the aldosterone synthase gene (CYP11B2) biallelic polymorphism in the promoter at position −344 (−344C/T) with essential hypertension and left ventricular hypertrophy in the Egyptian population. Methods: This study was conducted on 100 hypertensive patients (group I) and 50 healthy control subjects (group II). Serum aldosterone, plasma renin, ARR levels were investigated. Echocardiography was done to evaluate LV dimensions. Genotyping of the CYP11B2 gene was performed by PCR/RFLP confirmed by direct sequencing. Results: Our study revealed that CYP11B2 (−344T) allele was significantly higher than (−344C) allele in hypertensive patients as compared to healthy control (OR-2.51; 95% CI:1.3–3.5; P = 0.002) and −344TT genotype was associated with increased LVMI as compared with −344CC genotype (P = 0.001). Conclusion: A Significant association was observed between the CYP11B2 (−344C/T) polymorphism and −344T allele and essential hypertension in the Egyptian population. Also, we found that the CYP11B2 −344C/T polymorphism and −344T allele are associated with left ventricular hypertrophy which may predispose to cardiovascular complications of hypertension.

Keywords: Essential hypertension; CYP11B2; polymorphism; aldosterone; ARR

Essential hypertension, a major risk factor for cardiovascular disease, is a multifactorial disorder, predisposed by genetic and environmental factors ([1]). Left ventricular hypertrophy (LVH) is considered the main complication of hypertension. LVH is considered not only a common adaptation to increased hemodynamic load in hypertension but also one of the most important and independent risk factors for cardiovascular morbidity and mortality ([2]). LVH is estimated mainly by left ventricular mass (LVM) or left ventricular mass index (LVMI) in echocardiography ([3]).

Aldosterone is synthesized in the zona glomerulosa of the adrenal cortex from cholesterol by a series of oxidation and hydroxylation reactions catalyzed by specific cytochrome P450 enzymes. The final steps in the production of aldosterone including the 11β-hydroxylation of deoxycorticosterone to corticosterone, and the subsequent 18-hydroxylation and oxidation of corticosterone to produce aldosterone are catalyzed by an enzyme, aldosterone synthase ([4]).

Aldosterone synthase, a mitochondrial P450 oxidase, has steroid 11 β -hydroxylase, 18-hydroxylase and 18-oxidase activities ([4]) encoded by the CYP11B2 gene ([5]). The aldosterone synthase gene, CYP11B2, encode the aldosterone synthase enzyme, which synthesizes aldosterone, has been considered as a possible contributor to the development of hypertension ([6]). The CYP11B2 gene is located on the long arm of chromosome 8q, contains nine exons and eight introns, and was first discovered by Kawamoto and colleagues ([7]).

Three common polymorphic variants of CYP11B2 have been identified as potential genetic contributor in patients with essential hypertension; a single nucleotide polymorphism (C-344T) at promoter region, a conversion in intron 2 which is partly replaced by the corresponding intron of CYP11B1 gene, and a point mutation K173R in exon 3 ([8]).

Among the frequent polymorphisms described for the Aldosterone synthase (CYP11B2) gene, the (−344C/T) gene polymorphism in its transcriptional regulatory region has been reported to be associated with hypertension or with intermediate phenotypic indicators of aldosterone secretion. This polymorphism increases aldosterone to renin ratio (ARR) in essential hypertensives ([9]). This polymorphism involves a C/T substitution in a putative binding site for the steroidogenic transcription factor (SF-1) ([10]) with subsequent alteration in its binding affinity, which could result in an enhanced transcription rate leading to increased aldosterone synthesis either adrenal or intra-cardiac which promote smooth muscle proliferation of blood vessels and heart that predispose to essential hypertension and left ventricular hypertrophy ([11]).

Several studies of the association between CYP11B2 (−344C/T) polymorphism with essential hypertension and left ventricular hypertrophy have been published with controversial results. Whereas some have detected the higher frequency of −344T allele in hypertension and LVH ([12]–[14]), others reported a positive association of the C allele with hypertension ([15],[16]). Also, no evidence of a possible association was found by Tsujita et al. ([17]). These discrepancies might be due to race ([18]), age ([9]), gender ([19]), genetics epistasis ([20]) and environmental factors such as salt intake ([21]).

The hypothesis of the study is that if the CYP11B2 gene promoter is a putative SF-1 target for aldosterone synthesis, then the CYP11B2 (−344C/T) promoter gene polymorphism could be attributed to the development of essential hypertension and left ventricular hypertrophy. Accordingly, this possible contribution for which one of both CYP11B2 (−344C/T) alleles is responsible, may be a potential risk factor for essential hypertension and LVH in the Egyptian population.

The present study was aiming to investigate the association of the CYP11B2 gene polymorphism with essential hypertension and left ventricular mass in the Egyptian population.

This randomized case-controlled study was conducted on 100 patients (group I) who were recruited from the department of cardiology at Tanta university hospitals with systolic blood pressure (SBP) more than 140 mm Hg and/or diastolic blood pressure (DBP) more than 90 mmHg according to the criteria of The Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC 7) ([22]). In addition to 50 apparently healthy control subjects (group II) having no personal or family history of hypertension and had SBP <130 mmHg and DBP <85 mmHg with no history of cardiovascular, diabetes mellitus or other diseases or antihypertensive therapy.

Patients with the history of diabetes mellitus, hyperlipidemia, liver or renal disease, congestive cardiac failure, recent episode of myocardial infarction and patients receiving medications for other indications that could affect blood pressure were excluded from the study.

Participation in the study was voluntary after a written informed consent obtained from the subjects before the study. As part of the informed consent process, participants' rights as research subjects, confidentiality of data with secret codes, the privacy of participants, the possible risks and benefits were clearly explained. The study was performed according to the Helsinki declaration of good clinical practice and the protocol approved by the ethical committee of the faculty of medicine, Tanta University.

Complete history taking, including personal and family history and clinical examination with particular attention to the height, weight, with calculation of the body mass index (BMI) and blood pressure (BP) measurement according to American heart association (AHA) scientific statement ([23]) by the auscultatory Korotkoff technique were performed.

At left lateral decubitus position, using standard apical and parasternal views, left ventricular mass and systolic function were estimated by M-mode echocardiography using a General Electric Vivid 7 imaging system (GE Probe 5S), Yorba Linda, USA. Also, by using the apical view for visual estimation of cardiac chamber size and contractility as well as cardiac wall hypertrophy, and then left parasternal long axis view with obtaining M mode option, we can estimate left ventricular dimension, function and wall thickness definitely by numbers (Figure 1).

PHOTO (COLOR): Figure 1. M mode echocardiography of the left ventricle showing concentric left ventricular hypertrophy.IVSd, Interventricular septal end diastole; IVSs, Interventricular septal end systole; LVIDd, Left ventricular internal diameter end diastole; LVIDs, Left ventricular internal diameter end systole; LVPWd, Left ventricular posterior wall end diastole; LVPWs, Left ventricular posterior wall end systole; EDV, End-diastolic volume; ESV, End-systolic diameter; EF, Ejection fraction; SV, Stroke volume; FS, Fraction shortening.

Left ventricular hypertrophy was determined on the basis of calculation of LVM using the Penn formula: (LV mass (g) = 0.8 [1.04 (EDD+PWT+IVS)3–EDD3]) and of LVM index (LVMI) – value of LVM indexed to body surface area (g/m2) [normal values:<116 g/m2 in men and <104 g/m2 in women] ([24]). Relative wall thickness [RWT) was calculated as 2 X posterior wall thickness/end-diastolic diameter ratio, as reported by ([25]).

Ten milliliters of blood was withdrawn from each subject under complete aseptic precautions. Five milliliters were divided equally and placed into two K3 EDTA vacutainer tubes. One of them was stored at −20°C for molecular investigations and the other tube was centrifuged immediately after collection and the separated plasma was stored at −20 C for plasma active renin mass assay. The rest of the blood was placed in sterile vacutainer with a clot activator and was left to clot for 30 min. Serum was then separated by centrifugation at 1000 x g for 15 min and divided into two aliquots; one aliquot for immediate assay of the routine laboratory investigations as (blood glucose, lipid profile, serum sodium, potassium, and serum creatinine], while the remaining part of sera was aliquoted and stored at –20°C until used for the assay of serum aldosterone level.

Random glucose level, triglycerides, total cholesterol, HDL, LDL, and serum creatinine level were measured on Konelab 60 I Thermo Scientific autoanalyzer (Thermo Scientific, Finland) using commercial kits supplied by Thermo Fisher Scientific (Waltham, Massachusetts, United States). Serum electrolytes (sodium and potassium) were measured by ion selective electrode on Sensa Core ST-200 Plus electrolyte analyzer, Telangana, India.

The plasma active renin level and serum aldosterone level were estimated using a solid phase sandwich ELISA commercial kit supplied by DRG International, Inc., USA Catalog #: EIA-5125 & EIA-5298. All ELISA techniques were done according to the manufacturer's protocol and read on a microplate reader (Stat Fax®2100, Fisher Bioblock Scientific, France), at 450 nm. Unknown sample concentrations were calculated from the standard curve. Renin was measured as a plasma renin concentration (PRC) and ARR was calculated by dividing the serum aldosterone level in pg/ml by the plasma active renin concentration in pg/ml.

Whole blood was collected in EDTA vacutainer Tubes. Whole blood samples were stored at −20°C for molecular investigations. DNA was isolated from the peripheral frozen whole blood by using the DNA extraction kits (QIAamp DNA Blood Mini Kits, Qiagen, Hilden, Germany) according to the manufacturer's protocol. The DNA concentration in the elute was determined by measuring its absorbance (A) at 260 nm. On the other hand, the DNA purity was determined by calculating the ratio of the absorbance at 260 nm to the absorbance at 280 nm on Jenway UV/Visible Spectrophotometer 6305, Staffordshire, UK. Pure DNA had an A 260/A280 ratio of 1.7–2.0.

DNA extracts were amplified for the aldosterone synthase gene (CYP11B2) promoter using the primers: (Forward: 5ʹ CTCACCCAGGAACCTGCTCTGGAAACATA 3ʹ) (Reverse: 5ʹ CAGGAGGGATGAGCAGGCAGAGCACAG3ʹ). One-hundred and fifty nanograms of DNA extract (6 µl) was amplified in a 25 µL reaction containing 15 pmol of each primer (1.5 µl), 12.5 µl master mix (Roche Diagnostics GmbH, Mannheim, Germany, Catalog #: 11 636 103 001) (containing 1U Taq DNA polymerase, 0.2 mmol/L dNTP and 1.5 mmol/L MgCl2) and nuclease-free water (5 µl). The amplification was performed on a thermal cycler instrument (Biometra GmbH, Göttingen, Germany) with initial denaturation at 94 C for 5 min, amplification 45 cycles (94 C for 30 sec, 60 C for 30 sec, 72 C for 45 sec) and final extension at 72 C for 5 min. Agarose gel electrophoresis was performed on a Biometra compact electrophoresis system (Biometra GmbH, Göttingen, Germany) and PCR products were allowed to separate for 15 min at 120 V and visualized as a clear, sharp, distinct band at the specific molecular size (639 bp) by the ultraviolet transilluminator (Biometra GmbH, Göttingen, Germany) (Figure 2).

Graph: Figure 2. Representative agarose gel electrophoresis picture of CYP11B2 C-344T polymorphism by PCR/RFLP. Lanes 1 – DNA ladder; Lanes 2 and 3 – Homozygous mutant (TT); Lanes 4 and 6 – Heterozygous (CT); Lanes 5 and 7 – Wild type (CC); Lane 8, 9 and 10 – undigested PCR product.

The aldosterone synthase gene CYP11B2 −334C/T polymorphism was detected by PCR/RFLF as 1 µg of PCR product (15 µl) was added in a 25 µL reaction mixture containing 1 U (0.1 µl) of HAEIII restriction enzyme supplied by Roche Diagnostics GmbH, Mannheim, Germany, Catalog #: 10 693 944, 001, 2.5 µl of 10X SuRi/Cut buffer M and nuclease-free water and incubated at 37°C for 1 h then HAEIII restriction enzyme was thermally inactivated by incubation at 65°C for 15 min according to the manufacturer protocol. The digested PCR product was visualized after agarose gel electrophoresis by ultraviolet transillumination. The PCR product of 639 bp was subsequently cleaved by HaeIII, creating fragments for allele T 402, 138, 51 and 48 bp, and for allele C 334, 138, 68, 51 and 48 bp (Figure 2).

The results were confirmed by the direct sequencing. The amplified PCR products of each sample were purified using QIA quick PCR purification kit supplied by Qiagen, Hilden, Germany and undergo a cycle sequencing reaction by BigDye® Terminator v3.1 Cycle Sequencing Kit supplied by Applied biosystem, Foster City, California, USA and then purified by the CENTRI-SEP columns supplied by ThermoFisher Scientific, Carlsbad, California, USA according to the manufacturer protocol. The purified cycle sequence reaction products were injected into an automated genetic analyzer (Applied biosystem 310 genetic analyzer, Foster City, California, USA) (Figure 3).

PHOTO (COLOR): Figure 3. Electropherogram of CYP11B2 gene promoter showing −344C allele on the right and −344T allele on the left.

Aldosterone synthase gene (CYP11B2) promoter (GenBank accession no. NG_055453.1)

The differences between the studied groups were tested using an unpaired t-test for numerical data and chi-square test (χ2) for nominal data. The association between genotypes and hypertension risk was analyzed by calculating the odds ratio (OR) and 95% confidence interval (95% CI). One-way ANOVA was used in order to calculate the significance of the difference between the clinical parameters of groups. Statistical tests were performed with SPSS (IBM SPSS Statistics for Windows, IBM Corp, version 23.0. Armonk, NY, USA). P-values <0.05 were considered statistically significant.

Aldosterone, active renin concentrations were calculated in pg/ml from the standard curve drawn after estimation of each standard concentration against their optical density. (Supplemental data section: see Figure S1, S2). Genotyping of aldosterone synthase gene (CYP11B2) was performed by PCR/RFLP as illustrated in Figure 2. The PCR product represented as a sharp, distinct band at 639 bp. Also, PCR product digestion by HaeIII was performed creating fragments for Homozygous mutant (TT) as 402, 138, 51 and 48 bp; Wild type (CC) as 334, 138, 68, 51 and 48 bp while Heterozygous (CT) as 402, 334, 138, 68, 51 and 48 bp.

There was no statistical difference between the hypertensive patients (Group I) and the healthy control (Group II) regarding age, gender, height, and the smoking habit. The body weight and BMI were significantly higher in the hypertensive patients (Group I) as compared to the healthy control (Group II) (Table 1).

Table 1. Clinical and biochemical characteristics of the studied groups.

1 Notes: Data are expressed as mean ± standard deviation. n, number; BMI, Body Mass Index; SBP, Systolic Blood Pressure; DBP, Diastolic Blood Pressure; TC, Total Cholesterol; TAG, Triacylglycerol; HDL, high-density lipoprotein; LDL, low-density lipoprotein; RBS, Random Blood Sugar; ARR, Aldosterone Renin Ratio. *p < 0.05 vs control group.

The total cholesterol, triglyceride, LDL-cholesterol, random blood glucose level, serum sodium, serum creatinine, plasma aldosterone level and AAR were significantly higher while the HDL-cholesterol, serum potassium and plasma active renin level were significantly lower in the hypertensive patients (Group I) as compared to the healthy control (Group II) (Table 1).

The CYP11B2 −344TT genotype (χ2-11.64; P = 0.003) and −344T allele (OR-2.51; 95% CI:1.3–3.5; P = 0.002) (Table 2) were significantly higher than the CYP11B2 −344CC genotype and −344C allele in hypertensive patients (Group I) as compared to healthy control (Group II).

Table 2. Genetic characteristics of aldosterone synthase gene CYP11B2 polymorphism (C344T) in the studied groups.

2 Notes: n, number; OR, Odds Ratio; CI, Confidence Interval. *p < 0.05 vs control group.

There was no statistical difference between the three genotypes (TT,CT,CC) of the CYP11B2 (C344T) polymorphism in the hypertensive patients (Group I) regarding age, gender, hypertensive family history, BMI and SBP while DBP was significantly higher in TT genotype as compared to TC and CC genotypes (Table 3).

Table 3. Relation between CYP11B2 C344T Genotypes and Clinical, biochemical characteristics of the hypertensive patients' group.

3 Notes: Data are expressed as mean ± standard deviation. n, number BMI, Body Mass Index; SBP, Systolic Blood Pressure; DBP, Diastolic Blood Pressure; TC, Total Cholesterol; TAG, Triacylglycerol; HDL, high-density lipoprotein; LDL, low-density lipoprotein; RBS, Random Blood Sugar; ARR, Aldosterone Renin Ratio. *p < 0.05 vs control group.

There was no statistical difference between the three genotypes (TT, CT, CC) of the CYP11B2 (C344T) polymorphism in the hypertensive patients (Group I) regarding total cholesterol, triglyceride, HDL-cholesterol, LDL-cholesterol, creatinine, and serum sodium levels. The random blood glucose, aldosterone, and ARR were significantly higher and potassium and plasma active renin level were significantly lower in TT genotype as compared to TC and CC genotypes (Figure 4,Table 3).

PHOTO (COLOR): Figure 4. Aldosterone, active renin and AAR levels distribution among the CYP11B2 (C-344T) different genotypes.

There was a statistical difference among the three genotypes (TT, CT, CC) of the CYP11B2 (C344T) polymorphism in the hypertensive patients (Group I) regarding the left ventricular structure. The RWT, LVM, and LVMI were significantly higher in −344TT genotype as compared to −344TC and −344CC genotypes. Also, the −344TT genotype was associated with a significant increase in left ventricular EDD and a decrease in fraction shortening, left ventricular EDV, stroke volume and ejection fraction as compared to the −344TC and −344CC genotypes. (Table 4).

Table 4. Relation between CYP11B2 C344T Genotypes and Left ventricular dimensions of the hypertensive patient group.

4 Notes: Data are expressed as mean ± standard deviation. RWT, Right Wall Thickness; LVM, Left Ventricular Mass; LVMI, Left Ventricular Mass Index. LVEDD, Left ventricular end-diastolic diameter; LVESD, Left ventricular end systolic diameter; FS, Fraction shortening; LVEDV, Left ventricular end diastolic volume; LVESV, Left ventricular end systolic diameter; SV, Stroke volume; EF, Ejection fraction; CO, Cardiac output. *p < 0.05 vs control group.

The genotypic variance −344C/T in the promoter region of CYP11B2 gene is one of the most common aldosterone synthase gene polymorphisms. It persuades the binding of steroidogenic factor-1, the transcriptional regulatory protein ([26]). This polymorphism was suggested to increase aldosterone level, increase aldosterone to renin ratio (ARR) which leads to hypertension, increased left ventricular size and dysfunction ([12]). Although several studies have been performed in different ethnic groups, to our knowledge, this is the first report on the C-344T allele frequency in the Egyptian population.

In the present study, we investigate the possible association between CYP11B2 −344C/T polymorphism and the plasma aldosterone levels and aldosterone/renin ratio (Table 3) and we find that CYP11B2 TT genotype and −344T allele were associated with increased plasma aldosterone and ARR levels. Our findings are in agreement with several studies previously conducted and reported the relationship between −344 T allele and increased plasma aldosterone levels ([8],[9],[19]) associated with elevated AAR and hypertension ([27])

Functional studies explain this association by the lower binding affinity of −344 T allele to steroidogenic factor (SF-1). This prevents the enzyme transcription inhibition by SF-1 leading to increased aldosterone synthase activity ([26]). Also, it increases SF-1 factor availability in other parts of the gene that leads to transcriptional activation of the steroidogenic acute regulatory gene which stimulates aldosterone synthase gene transcription ([8]). Others suggest that CYP11B2 polymorphisms are in strong linkage disequilibrium with functional polymorphisms in CYP11B1; a T to C substitution in codon 75 and a G to A substitution in intron 6 and that leads to 11 β hydroxylase deficiency ([28]) with a sustained mild increase in ACTH drive to the adrenal cortex to maintain normal plasma cortisol levels ([29]). Accordingly, ACTH stimulates aldosterone synthesis via enhancing the expression of a number of genes required for aldosterone synthesis, including StAR, CYP11A, and CYP21 resulting in hypertension with a raised ARR ([29],[30]).

In the present study, we evaluate the potential role of CYP11B2 −344C/T polymorphism and susceptibility to essential hypertension and we confirmed that the homozygous variant (−344 TT) genotype and −344 T allele were significantly higher than (−344 CC) genotype and −344 C allele in hypertensive cases than the controls (X2- 11.64; P = 0.003 & OR-2.51; 95% CI: 1.3–3.5; P = 0.002) (Table 2). The findings of our study are in agreement with Sookoian et al. ([31]), meta-analysis, who showed a 17% greater risk of essential hypertension among the −344TT counterparts and the studies previously conducted in Caucasian ([14]), highlanders compared to lowlanders Indian ([13]) and Tamil population ([12]). On the other hand, a positive association of the C allele with hypertension had been reported by Tsukada et al. ([32]), Kumar et al. ([16]), and Xu et al. ([15]), with no association as found in a Japanese population ([17]). These inconsistent results could reveal the influence of the different genetic background and environmental factors in geographically separated populations.

Also, our study investigates the role of the CYP11B2 (−344C/T) polymorphism in the predisposition of left ventricular hypertrophy in essential hypertension and we detected that the CYP11B2 −344TT genotype associated with increased LVM, LVMI, and RWT (P = 0.001) (Table 4) if compared with the −344CT and −344CC genotype. These findings were in agreement with Stella et al. ([33]), a study conducted among 210 patients affected by mild-to-moderate essential hypertension suggesting that −344C/T polymorphism affects LV mass and thickness in essential hypertension, independent of adrenal aldosterone.

The possible explanation of the previous association is the identification of the 344T-allele of the CYP11B2 gene as a "damaging" allele by Kurbanova and Eliseyeva ([34]), together with the 235T-allele of the AGT gene, the D-allele of the ACE gene. The severity of LVH significantly increased with the increased number of "damaging" alleles which are considered as genetic markers. The increased aldosterone synthesis in the presence of the −344T allele either adrenal or intracardiac ([35]) plays a major role in the smooth muscle cells growth enhancement, macrophages activation of blood vessels and heart leading to the development of hypertension, atherosclerosis, cerebral stroke, myocardial hypertrophy and fibrosis ([11]).

In conclusion, our study revealed that the −344C/T polymorphism and (−344T) allele of the aldosterone synthase (CYP11B2) gene are associated with increased aldosterone level and increased aldosterone/renin ratio that predisposes to essential hypertension which is consistent with the majority of the studies. Also, we found a significant association of the −344C/T polymorphism and (−344TT) allele with left ventricular hypertrophy which predisposes to cardiovascular complications of hypertension.

The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.

Supplementary data for this article can be accessed https://doi.org/10.1080/10641963.2018.1557679