RIO-kinase 2 is essential for hematopoiesis

Introduction

Regulation of protein synthesis is a key factor in hematopoietic stem cell maintenance and differentiation. Rio-kinase 2 (RIOK2) is a ribosome biogenesis factor that has recently been described an important regulator of human blood cell development. Additionally, we have previously identified RIOK2 as a regulator of protein synthesis and a potential target for the treatment of acute myeloid leukemia (AML). However, its functional relevance in several organ systems, including normal hematopoiesis, is not well understood. Here, we investigate the consequences of RIOK2 loss on normal hematopoiesis using two different conditional knockout mouse models. Using competitive and non-competitive bone marrow transplantations, we demonstrate that RIOK2 is essential for the differentiation of hematopoietic stem and progenitor cells (HSPCs) as well as for the maintenance of fully differentiated blood cells in vivo as well as in vitro. Loss of RIOK2 leads to rapid death in full-body knockout mice as well as mice with RIOK2 loss specific to the hematopoietic system. Taken together, our results indicate that regulation of protein synthesis and ribosome biogenesis by RIOK2 is essential for the function of the hematopoietic system.

The precise regulation of protein synthesis is essential for the homeostasis of hematopoietic stem cells [[1]]. Ribosome levels play a central role in translational regulation and lineage commitment of the hematopoietic system [[2]]. Mutations in genes coding for ribosome biogenesis factors, ribosomal proteins as well as other components of the translational machinery are often associated with dysfunctional hematopoiesis and hematological diseases such as Diamond-Blackfan anemia, Schwachman Diamond syndrome and T-cell lymphoblastic leukemia [[3]].

RIO kinase 2 (RIOK2) is an atypical kinase that has previously been reported to be involved in the export, assembly and maturation of 40S ribosomal proteins and therefore the regulation of mRNA translation to protein [[5]]. The binding of RIOK2 to the pre-40S subunit has been shown to block premature translation initiation by preventing the binding of translation initiation factors to the pre-40S subunit. Haploinsufficiency of Riok2 leads to decreased erythroid precursor frequency causing anemia [[7]], and several studies have highlighted a role of RIOK2 in various cancer types [[8]]. A recent study identified RIOK2 as a transcriptional regulator of key hematopoietic transcription factors such as GATA1, GATA2, SPI1, RUNX3 and KLF1 [[10]]. Recently, we have shown that RIOK2 is required for maintaining protein synthesis and ribosomal stability in leukemic cells, and we have therefore proposed RIOK2 as a potential therapeutic target for AML therapy [[11]].

To assess the suitability of RIOK2 as a potential target for hematological malignancies, it is critical to understand the functional consequences of RIOK2 loss on normal hematopoiesis. Here, we report on the consequences of RIOK2 loss on hematopoietic stem and progenitor cells as well as mature blood cells using two different conditional Riok2 knockout mouse strains.

Materials and methods

Animal studies and mouse strains

Riok2 fl/fl ; Rosa26::CreERT2 and Riok2fl/fl; Mx1::Cre mice were generated as previously described [[11]]. All mouse experiments conducted in Denmark were approved by the Danish Animal Ethical Committee (license number: 2017-15-0201-01176). All mouse experiments conducted in the UK were approved by the Animals in Science Regulation Unit (license number: PP5781054). All staff and animal technicians have the accreditation needed to conduct animal experiments in each country and are trained to keep animal welfare to a high standard.

Competitive bone marrow transplantation and FACS analysis of the peripheral blood

B6-SJL mice were lethally irradiated (900 rad) followed by a transplantation of 50,000 Riok2fl/fl; Rosa26::CreERT2 or Riok2fl/+; Rosa26::CreERT2 cells mixed with wild-type cells in a 1:1 ratio via tail vein injection. Four mice were used in each group. The mice were shielded from one another for them not to see injections performed on all animals. Once injections with tamoxifen were started to induce Riok2 floxing animals were checked twice a day. Tamoxifen dissolved in corn oil was administered at 75 mg/kg bodyweight via intraperitoneal injection (using an ACUC approved injection procedure) once every 24 hours for a total of 5 consecutive days. FACS analysis of the peripheral blood was performed to determine the relative engraftment. Red blood cells were lysed using ammonium chloride solution (0.8% NH4Cl) followed by a washing step using 3% FBS in PBS. Antibodies used for cell surface marker detection by FACS can be found in Table 1. FACS analysis was performed 4, 8, 12 and 16 weeks after transplantation and Tamoxifen injection.

Graph

Table 1 FACS antibodies used in this study.

Antigen	Fluorophore	Manufacturer	Clone
c-KIT	PE-Cy7	Invitrogen	2B8
CD45.1	APC-Cy7	BD Pharmigen	A20
CD45.2	AF700	BD Pharmigen	104
Sca-1	APC	Invitrogen	D7
CD3e	PE-Cy5	eBioscience	145-2C11
CD150	BV650	BioLegend	TC15-12F12.2
CD48	FITC	Invitrogen	HM4B-1
CD16	PE	eBioscience	93
CD32	PE	eBioscience	93
Ter119	PE	eBioscience	TER-119
CD71	APC	Invitrogen	R17217
CD11b (Mac-1)	BV786	BD Biosciences	M1/70
Gr-1	BV605	BioLegend	RB6-8C5
CD19	BV650	BD Horizon	1D3
CD4	PE-Cy5	Invitrogen	GK1.5
CD8	PE-Cy5	Invitrogen	53–6.7
CD45.1	PE	BioLegend	A20
CD45.2	BV421	BioLegend	104
Sca-1	SB436	Invitrogen	D7
CD48	BV510	BioLegend	HM48-1
CD45.2	FITC	BioLegend	104
CD135	PE-CF594	BD Biosciences	A2F10.1
CD150	PE-Cy7	BioLegend	TC15-12F12.2
CD34	eFluor 660	Invitrogen	RAM34
CD16/32	APC-R700	BD Biosciences	2.4G2
c-KIT	APC-eFluor 780	Invitrogen	2B8

1 The lineage cocktail consisted of CD3e, Gr-1, CD11b, B220 and Ter119 (all PE-Cy5, BioLegend). In white are the antibodies used for the competitive transplant, and in blue the antibodies used for the non-competitive transplant.

Non-competitive bone marrow transplantation and FACS analysis of the peripheral blood

B6-SJL mice were lethally irradiated (950 rad) and transplanted with 440,000 Riok2fl/fl; Rosa26::CreERT2 bone marrow cells via tail vein injection. Engraftment was confirmed by blood sampling 4 weeks post-transplant. Blood samples were lysed using RBC lysis buffer (Biolegend. Cat no: 420302) for 10 minutes, followed by a wash in 2% FBS in PBS. Antibodies used to determine the engraftment efficiency can be found in Table 1. Tamoxifen dissolved in corn oil was administered at 75 mg/kg bodyweight via intraperitoneal injection. Injection of 100 μL corn oil was used for control mice. Four animals were used in each group. The mice were shielded from one another for them not to see injections performed on all animals. Injections with tamoxifen or corn oil were given every day for a total of 5 consecutive days. Bone marrow was collected 10 days after the last tamoxifen or corn oil injections. Mouse wellbeing and survival was monitored daily after injection of polyIC or tamoxifen, respectively. Signs of illness, including weight loss, bad appearance of fur, hunching, grimace scale and overall motility were assessed daily for each animal. All animals were euthanized immediately (within 5 minutes or less) upon visible signs of illness using cervical dislocation. No anesthesia or analgesia or methods to alleviate suffering were necessary during the experiments. No animals died before meeting the criteria for euthanasia.

Whole body knockout of Riok2

6 to 12 weeks old Riok2fl/fl; Riok2fl/+; or Riok+/+; Rosa26::CreERT2 mice were injected with tamoxifen as described above in the non-competitive transplant setting. Mx1::Cre mice were intraperitoneally injected with 0.4 mg Polyinosinic:polycytidylic acid (polyIC) dissolved in PBS. Four animals were used in each group. The injections were repeated every other day for a total of five injections over the course of 10 days. Mouse wellbeing and survival was monitored daily after injection of polyIC or tamoxifen, respectively. Signs of illness, including weight loss, bad appearance of fur, hunching, grimace scale and overall motility were assessed daily for each animal. All animals were euthanized immediately (within 5 minutes or less) upon visible signs of illness using cervical dislocation. No anesthesia or analgesia or methods to alleviate suffering were necessary during the experiments. No animals died before meeting the criteria for euthanasia.

Cell culture

LSK cells were sorted from Riok2fl/fl; Rosa26::CreERT2 mice using a BD FACSAria III cell sorter (BD Biosciences) and subsequently cultured in X-VIVO 15 medium (Lonza, Cat.-Nr.: BE02-060F) containing 1% Pen/Strep, 2 mM L-Glutamine, 1% BSA, 0.1 mM beta-mercaptoethanol, 50 ng/ml mSCF, 10 ng/μl mIL-3, 50 ng/μl mIL-6.

EdU labeling-based cell cycle analysis

LSK cells cultured in X-VIVO medium isolated from Riok2fl/fl; ROSA26::CreERT2 and Riok2fl/+; ROSA26::CreERT2 mice were treated with 10 μM 4-hydroxytamoxifen (OHT) or ethanol (EtOH) for 5 days after 48 hours in culture. EdU incorporation was measured using the Click-iT EdU Alexa Fluor 488 Flow Cytometry Assay Kit (Thermo Fisher, Cat.-Nr.: C10425) according to the manufacturer's instructions using 1 μM EdU and a labeling time of 45 minutes. Cells were stained with DAPI (1 μg/ml) before analysis. Flow cytometry was performed on a BD FACSAria III (BD Biosciences) and data analysis was performed using FlowJo software.

Colony formation assay

Single-cell suspension of mouse bone marrow was enriched for c-KIT using CD117 microbeads (Miltenyi Biotech). Cells were stained with the indicated antibodies on ice for 30 minutes and subsequently sorted for the desired population on a BD FACSAria III sorter (BD Biosciences). Cells were plated into methylcellulose-based medium (M3534, StemCell Technologies) according to manufacturer's protocol at a density of 1,000 to 10,000 cells per ml. Colonies were counted manually on an inverted microscope with STEMgrid-6 and serial replating was performed in triplicates every week.

Bone marrow FACS analysis

For the competitive transplantation experiments, femur, tibia and fibula were collected from both hind legs of the sacrificed mice. The bones were cleaned from flesh and crushed in a mortar under sterile conditions. The mortar was washed twice with 3 ml 3% FBS in PBS to collect all cells that were then filtered through a sterile 70 μm filter. After spinning, the cells were resuspended in 100 μl 3% FBS in PBS and 10 μl CD117 (c-KIT) beads (Mitenyi, Cat.-Nr: 130-091-224) and incubated for 15 minutes at 4°C. After washing, the cells were separated using the MACS separator system (Miltenyi Biotech) according to the manufacturer's instructions. Subsequently, the cells were counted and resuspended in the appropriate mix of antibodies for sorting or analysis.

For the non-competitive transplantation experiments, both hindlegs, hips and spine were harvested, cleaned, and crushed using a mortar and pestle. The mortar was washed in a total of 50 ml 3% FBS in PBS to collect all cells that were then filtered through a sterile 70 μm filter. After spinning, the samples were lysed using RBC lysis buffer (Biolegend. Cat no: 420302) for 3 min, followed by two washes in 3% FBS in PBS. Next, the cells were resuspended in 500 μl 3% FBS in PBS and 10 μl CD117 (c-KIT) beads (Mitenyi, Cat.-Nr: 130-091-224) and incubated for 20 minutes at 4°C. After washing, the cells were separated using the MACS separator system (Miltenyi Biotech) according to the manufacturer's instructions. Cells were counted and resuspended in a total volume of 100 μl for staining, followed by incubation with FACS antibodies for 90 minutes on ice. Samples were acquired on the CytoFLEX LX (Beckman Coulter), and data were analysed using FlowJo. Absolute cell numbers were calculated based on the frequency of donor cells (CD45.2 positive) in each indicated population among single cells. The obtained frequency of single cells was then multiplied by the total number of isolated cells after processing the bone marrow to obtain the cell numbers displayed in Fig 1C.

Graph: A) Schematic overview of the competitive bone marrow transplantation. Lethally irradiated B6/SJL mice were injected with a mix of bone marrow cells from Riok2fl/fl; Rosa26:CreERT2 or Riok2fl/+; Rosa26:CreERT2 mice and cells from wild-type B6-SJL mice in a 1:1 ratio. 4 weeks after transplantation, all animals were injected intraperitoneally with tamoxifen to induce Cre-mediated recombination of the Riok2 locus. Created with Biorender.com. B) CD45.2 chimerism in the indicated peripheral blood cell types 4, 8, 12 and 16 weeks after bone marrow transplantation. Data is represented as mean ± standard deviation (SD). n = 4 animals per group. **: p<0.01; ***: p<0.001 by Unpaired t-test. C) Bar graphs depicting the absolute number of CD45.2 positive cells in each indicated population of mice transplanted with Riok2fl/fl; Rosa26:CreERT2 treated with corn oil (control) or tamoxifen. Data is represented as mean ± standard deviation (SD). n = 4 animals per group. **: p<0.01; ****: p<0.0001 by 2way ANOVA test followed by Tukey's multiple comparison test. D) Kaplan-Meier survival curves of the indicated transgenic mouse strains after deletion of Riok2 using tamoxifen (left panel) or polyIC (right panel). n = 4 animals per group. E) Bone marrow histology revealed by HE-staining of bone marrow from Riok2+/+, Riok2fl/+, or Riok2fl/fl; Rosa26:CreERT2 mice collected 20 days after tamoxifen treatment or upon death. Scale bar represents 100 μm.

The antibodies used for FACS analysis can be found in Table 1.

Bone marrow histology

Tibia were dissected from the Riok2+/+, Riok2fl/+; Rosa26::CreERT2 mice 20 days after tamoxifen treatment start or upon death for Riok2fl/fl; Rosa26::CreERT2 mice. The bones were decalcified by incubation in 10% EDTA and fixed using 4% PFA. Processing, sectioning and HE staining of bones was performed using standard protocols [[12]].

Genotyping

Genotyping was performed on DNA extracted from mouse tail tissue using the primer sequences shown in Table 2 using standard PCR protocols. Tail DNA was extracted by heating mouse tail tissue samples in 180 μl of 50 mM NaOH for 10 minutes at 95°C followed by the addition of 20 μl of 1M Tric-HCl (pH 8.0).

Graph

Table 2 Sequences for PCR primers used in this study.

Primer name	Sequence (5'-3')
Riok_mouse_Common_en2_F_out	ACTTCTTACGCCAGGAACCT
Riok_mouse_Common_en2_R	CCAACTGACCTTGGGCAAGAACAT
Common_LoxP_F	GAGATGGCGCAACGCAATTAAT
Common_LoxP_R_outside	TGCTTGAATAAATGGCTCCCTG
Common_3'_F	CACACCTCCCCCTGAACCTGAAA
Flp_KOMP_rev	CTTTTGGAAGAGCAGTCAGG

Immunoblotting

500.000 LSK cells per treatment group were harvested and lysed in by the addition of 100 μl 1X LSB buffer to 300μl of PBS. The lysates were boiled at 95°C for 10 minutes. 50 μl of each sample were loaded on NuPAGE™ 4 to 12%, Bis-Tris, 1.0–1.5 mm, Mini Protein Gels (Thermo Fisher, Cat no: NP0322BOX). SDS-PAGE and blotting were performed according to standard protocols. Antibodies used for the immunoblotting are shown in Table 3.

Graph

Table 3 Western Blot antibodies used in this study.

Epitope	Manufacturer	Application	Dilution	Cat.-No.
Mouse RIOK2	Genscript (custom order)	Western Blot	1:4000	-
β-tubulin	abcam	Western Blot	1:5000	ab15568

Results

To determine the role of RIOK2 in hematopoiesis, we performed a series of competitive and non-competitive bone marrow transplantation experiments. In the first approach, we mixed bone marrow cells from a previously established transgenic mouse line carrying floxed Riok2 alleles [[11]] (S1A Fig) and a tamoxifen inducible Cre (CreERT2) expressed from the Rosa26 locus (Riok2fl/fl; Rosa26::CreERT2 and Riok2fl/+; Rosa26::CreERT2), and cells from a wild-type B6-SJL mouse in a 1:1 ratio. The mixed bone marrow cells were transplanted into lethally irradiated B6-SJL mice (Fig 1A). After verifying the contribution of Riok2fl/fl; Rosa26::CreERT2 and Riok2fl/+; Rosa26::CreERT2 cells to different lineages of the peripheral blood at 4 weeks post-transplantation (S1B Fig), we injected tamoxifen intraperitoneally to induce the recombination of the Riok2 locus [[13]] (S1C Fig) We measured the contribution of Riok2fl/fl; Rosa26::CreERT2 and Riok2fl/+; Rosa26::CreERT2 bone marrow cells (CD45.2+) to the peripheral blood 4, 8,12 and 16 weeks after transplantation (Fig 1B). We observed a loss of both myeloid and lymphoid CD45.2+ cells in the transplanted mice (Fig 1B). In contrast, heterozygous loss of Riok2 did not lead to significant changes in the analyzed hematopoietic cells (Fig 1B). These results suggest that RIOK2 is essential for the maintenance of mature peripheral blood cells.

To investigate the consequences of RIOK2 loss on hematopoietic stem and progenitor cells, we performed a non-competitive bone marrow transplant where we used bone marrow collected from Riok2fl/fl; Rosa26::CreERT2 mice as donor cells and B6-SJL mice as recipients. After validation of successful engraftment (S1D Fig), we performed tamoxifen injections in half of the transplanted mice. The other half received corn oil injections as a control. To assess the effect of RIOK2 loss on different stem and progenitor cell types, we collected bone marrow cells 10 days after the last injections and performed flow cytometry, as the mice started to develop symptoms of bone marrow failure. The result of this analysis showed that RIOK2 loss led to a significant decrease of all stem and progenitor cell types, including LSK, GMP, CMP, MEP, LT-HSC and ST-HSC populations (Figs 1C and S1E and S1F). This result indicates that in addition to being essential for peripheral blood cells, RIOK2 is also essential for the maintenance of hematopoietic stem and progenitor cells in the bone marrow.

To assess the consequence of RIOK2 loss in adult mice, we treated Riok2fl/fl; Rosa26::CreERT2, Riok2fl/+; Rosa26::CreERT2, and Riok2+/+; Rosa26::CreERT2 mice with tamoxifen. Whereas the loss of both alleles of Riok2 led to rapid death of the mice with a median survival of 14.5 days, mice expressing one allele or control mice were not affected by tamoxifen treatment (Fig 1D, left panel). Inducing RIOK2 loss specifically in the hematopoietic system using a Mx1::Cre driven recombination of the Riok2 allele also led to the rapid death of the mice with a median survival of 23.5 days (Fig 1D, right panel). To investigate the consequences of RIOK2 loss on the bone marrow morphology, we collected tibia from dead mice and performed bone marrow histology. We observed a significant loss of bone marrow cellularity in Riok2fl/fl; Rosa26::CreERT2 but not in Riok2+/+ or Riok2fl/+ mice, indicating that RIOK2 is essential for cellular homeostasis in the bone marrow (Fig 1E).

To further investigate the phenotypic consequences of RIOK2 loss, we investigated the effects of its depletion on differentiation, self-renewal and proliferation of HSPCs in vitro (Fig 2A). For this, we sorted LSK cells isolated from Riok2fl/fl; Rosa26::CreERT2 and Riok2fl/+; Rosa26::CreERT2 mice, which had been treated with 4-hydroxytamoxifen (OHT) prior to sorting. As shown in S2A Fig, this led to the decrease of RIOK2 protein levels in the OHT-treated LSK cells. The abrogation of RIOK2 expression led to a significant increase in the relative number of Lin- and LSK cells (Figs 2B and S2B), potentially indicating that more mature hematopoietic cell types are more sensitive to the acute loss of RIOK2. Moreover, Riok2 knockout cells showed a strong decrease in the capacity to form colonies in methylcellulose (Fig 2C). These results further support our data showing that RIOK2 is required for hematopoietic stem cell maintenance.

Graph: A) Experimental outline to determine the effects of RIOK2 loss on hematopoietic stem and progenitor cells in vitro. Created with Biorender.com. B) Percentage of Lin- cells and LSK cells 48h after the addition of either ethanol (EtOH) or 4-hydroxytamoxifen (OHT) to the culture medium of Riok2fl/fl; Rosa26:CreERT2 and Riok2fl/+; Rosa26:CreERT2 cells. Data is represented as mean ± standard deviation (SD). n = 3 biological replicates per group. A Student's t-test was performed to assess statistical significance (ns = not significant, *p<0.05, ***p<0.001). C) MethoCult replating assay using LSK cells sorted from bone marrow of the indicated genotypes. Cells were replated once per week. Data is represented as mean ± standard deviation (SD). n = 3 biological replicates per group. D) Left panel: EdU labeling of Riok2fl/fl; Rosa26:CreERT2 and Riok2fl/+; Rosa26:CreERT2 LSK cells. Error bars represent standard deviation (SD), n = 3 biological replicates. Right panel: representative FACS plot of Riok2fl/fl treated with either EtOH or OHT for 5 days.

Lastly, to determine the effects of RIOK2 loss on cell proliferation in more detail, we performed a FACS-based EdU labeling assay on LSK cells. This analysis showed that deletion of Riok2 led to cell cycle arrest and apoptosis in Riok2fl/fl LSK cells as indicated by a strong increase in the sub-G1 fraction (Fig 2D).

Discussion

We have addressed the phenotypic consequences of RIOK2 loss on the hematopoietic system and mouse survival. Collectively, our data suggests that RIOK2 is required for the expansion, homeostasis and differentiation of hematopoietic stem and progenitor cells as well as for the homeostasis of lymphoid and myeloid cells in the peripheral blood. These results are in agreement with recent data showing a key role for RIOK2 in the transcriptional regulation of blood cell development [[10]]. Additionally, loss of RIOK2 strongly affects hematopoietic stem and progenitor cell survival in vivo as well as the differentiation, self-renewal and proliferation of HSPCs in vitro. We have also observed a relative increase in Lin- as well as LSK cells upon loss of RIOK2 in vitro, which may be because more mature hematopoietic cells have higher rates of protein synthesis [[1]] and thereby are more sensitive to RIOK2 loss. Recently, we showed that loss of RIOK2 in mouse embryonic fibroblasts leads to a stop in proliferation and induction of senescence, indicating that RIOK2 is not required for cell survival per se [[11]]. While the results lower the attractiveness of pursuing RIOK2 inhibition as a pharmacological target, several inhibitors of ribosome biogenesis and protein synthesis are currently in clinical trials, such as the ribosome biogenesis inhibitor CX-5461 [[14]]. Further investigations will be necessary to understand the tissue specific dependency of RIOK2.

In summary, we have demonstrated that RIOK2 is required for homeostatic maintenance of the hematopoietic system as well as hematopoietic stem and progenitor cells. Further studies are required to investigate if there is a therapeutic window allowing for the safe and efficient targeting of RIOK2 in cancer.

Supporting information

S1 Fig

A) Schematic overview of the Riok2fl/fl locus. Exons 4 and 5 are flanked by LoxP site that are excised after the induction of Cre recombinase. B) Representative FACS plots showing the engraftment of Riok2fl/fl and Riok2fl/+ B-cells 4 weeks after transplantation using CD45.1/CD45.2 staining. C) Agarose gel showing the genotyping of the transplanted bone marrow of ROSA26::CreERT2, Riok2fl/+ and Riok2fl/fl mice used in the competitive bone marrow transplantation assay after termination of the experiment. Arrows indicate wild-type and floxed as well as recombined and non-recombined alleles. The lanes between the bottom and top gels are matched and represent the same mice. D) Bar graph depicting the percentage of CD45.1 or CD45.2 positive cells in lethally irradiated mice transplanted with Riok2fl/fl; Rosa26::CreERT2. Data is represented as mean ± standard deviation (SD) (n = 8). ****: p<0.0001 by Unpaired t-test. E) Gating strategy for HSPC population identification and representative result for mice injected with corn oil. F) Gating strategy for HSPC population identification and representative result for mice injected with tamoxifen and experiencing symptoms of bone marrow failure.(TIF)

S2 Fig

A) Immunoblot showing RIOK2 protein levels in LSK cells cultured in X-VIVO medium from the indicated genotypes 48 hours after the addition of either EtOH or OHT to the culture medium. B) Representative FACS plots for X-VIVO cultured LSK cells 48 hours after the addition of EtOH or OHT to the culture medium.(TIF)

S1 Raw images

(PDF)

S1 File

(XLSX)

Decision Letter 0

Han Jimin Academic Editor

8 Jan 2024

PONE-D-23-40786RIO-kinase 2 is essential for hematopoiesisPLOS ONE

Dear Dr. Helin,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE's publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Feb 22 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Jimin Han

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at 

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne%5fformatting%5fsample%5fmain%5fbody.pdf and 

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

• 2. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information regarding the experiments involving animals and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering.
• 3. Thank you for stating the following in the Competing Interests section: 

[K.H. is a consultant for Dania Therapeutics Aps and a scientific advisor for Hannibal Health Innovation. The other authors declare no competing interests.]. 

Please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials, by including the following statement: ""This does not alter our adherence to  PLOS ONE policies on sharing data and materials." (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests).  If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared. 

Please include your updated Competing Interests statement in your cover letter; we will change the online submission form on your behalf.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission's figures or Supporting Information files. This policy and the journal's other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. 

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

5. We note that Figure 1A, 1E, 2A and 2E in your submission contain copyrighted images. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:

a. You may seek permission from the original copyright holder of Figure 1A, 1E, 2A and 2E to publish the content specifically under the CC BY 4.0 license. 

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

"I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form."

Please upload the completed Content Permission Form or other proof of granted permissions as an ""Other"" file with your submission. 

In the figure caption of the copyrighted figure, please include the following text: "Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year]."

b. If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder's requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.

Additional Editor Comments:

Dear Dr. Kristian Helin

This research paper, titled " RIO-kinase 2 is essential for hematopoiesis" explores the role of RIO-kinase 2 (RIOK2) in hematopoiesis, the process of blood cell formation. The study uses conditional knockout mouse models to demonstrate that RIOK2 is crucial for the differentiation and maintenance of hematopoietic stem and progenitor cells, as well as for the survival of fully differentiated blood cells. The absence of RIOK2 leads to rapid death in mice, indicating its vital role in the hematopoietic system. This research provides insights into the potential targeting of RIOK2 for treating blood cell-related disorders. The whole story is quite in-depth and it's very interesting. I'm including feedback from two expert reviewers regarding your manuscript. Their insights highlight the study's potential while also presenting various critiques and recommendations. After read reviewer's feedback, I believe this article requires careful revision. So, I decide give you major revision decision.

It's our hope that you find this feedback constructive. Should additional data be available to address the raised concerns, we are open to examining a modified submission. Our timeline is adaptable for any necessary extended research. For submissions linked to a specific thematic issue, please liaise with the editorial team concerning resubmission deadlines. We emphasize that key findings must be backed by comprehensive statistics from ample independent trials. Manuscripts may be returned at the editor's discretion for the completion of any lacking or partial statistical data.

I strongly suggest rearranging the figures, so they are more reader-friendly and more clearly. For more details, please refer to the layout instructions of PLOS ONE.

Yours sincerely,

Jimin Han

Academic Editor,

PLOS ONE

Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer 1:

The study explores the role of RIOK2 in blood cell formation, both in vivo and in vitro, with the manuscript conveying an evident phenotype associated with the knockout of RIOK2.

Major Point:

The figures included in the main text are of such low quality that it is difficult to discern the text within the images. Enhancement of image clarity is necessary.

Minor Points:

In Fig S1C, concerning the lower image of genotyping, it is unclear what the genotype is for the control. Why do two lanes of ctrl display mismatched bands?

Is it critical to establish the baseline levels of CD45.1 and CD45.2 in mice before the transplantation process? Additionally, would it enhance clarity to more distinctly show the reduction of CD45+ cells following radiation?

Some of the statistical charts, like those in Figure 1B, 1C, and FigS1D, would benefit from an analysis of significance to support the findings.

Reviewer 2:

RIOK2 is important for hematopoietic stem cell（HPSC）maintance and differentiation. This manuscript investigates the effects of RIOK2 on HPSC function and HPSC transplantation using a conditional knockout mouse model in the hematopoietic system. The research findings have significant implications for understanding HPSC function and transplantation. However, revisions need to be made to the manuscript before it can be accepted.

In Figure 1, we propose that both Riok2fl/fl; Rosa26::CreERT2 and Riok2fl/+; Rosa26::CreERT2 have the effect of downregulating RIOK2 gene expression. Why was Riok2+/+; Rosa26::CreERT2 mice not used as a control?

In Supplementary Figure 1, should there be additional images demonstrating the efficiency of RIOK2 gene knockdown in Riok2fl/fl; Rosa26::CreERT2 and Riok2fl/+; Rosa26::CreERT2 mice, rather than solely relying on DNA-level identification?

In Figure 2, the experimental data regarding the impact of Riok2 knockout on HSC proliferation and differentiation is insufficient to support the authors' conclusions. Are there additional evidence available to substantiate these claims?

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

***

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

***

3. Have the authors made all data underlying the findings in their manuscript fully available?

The http://www.plosone.org/static/policies.action#sharing requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

***

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

***

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: 

RIOK2 is important for hematopoietic stem cell（HPSC）maintance and differentiation. This manuscript investigates the effects of RIOK2 on HPSC function and HPSC transplantation using a conditional knockout mouse model in the hematopoietic system. The research findings have significant implications for understanding HPSC function and transplantation. However, revisions need to be made to the manuscript before it can be accepted.

In Figure 1, we propose that both Riok2fl/fl; Rosa26::CreERT2 and Riok2fl/+; Rosa26::CreERT2 have the effect of downregulating RIOK2 gene expression. Why was Riok2+/+; Rosa26::CreERT2 mice not used as a control?

In Supplementary Figure 1, should there be additional images demonstrating the efficiency of RIOK2 gene knockdown in Riok2fl/fl; Rosa26::CreERT2 and Riok2fl/+; Rosa26::CreERT2 mice, rather than solely relying on DNA-level identification?

In Figure 2, the experimental data regarding the impact of Riok2 knockout on HSC proliferation and differentiation is insufficient to support the authors' conclusions. Are there additional evidence available to substantiate these claims?

Reviewer #2: The study explores the role of RIOK2 in blood cell formation, both in vivo and in vitro, with the manuscript conveying an evident phenotype associated with the knockout of RIOK2.

Major Point:

The figures included in the main text are of such low quality that it is difficult to discern the text within the images. Enhancement of image clarity is necessary.

Minor Points:

In Fig S1C, concerning the lower image of genotyping, it is unclear what the genotype is for the control. Why do two lanes of ctrl display mismatched bands?

Is it critical to establish the baseline levels of CD45.1 and CD45.2 in mice before the transplantation process? Additionally, would it enhance clarity to more distinctly show the reduction of CD45+ cells following radiation?

Some of the statistical charts, like those in Figure 1B, 1C, and FigS1D, would benefit from an analysis of significance to support the findings.

***

6. PLOS authors have the option to publish the peer review history of their article (https://journals.plos.org/plosone/s/editorial-and-peer-review-process#loc-peer-review-history). If published, this will include your full peer review and any attached files.

If you choose "no", your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our https://www.plos.org/privacy-policy.

Reviewer #1: Yes: Jia He

Reviewer #2: No

***

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Author response to Decision Letter 0

19 Feb 2024

Journal requirements

1. When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne%5fformatting%5fsample%5fmain%5fbody.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

We have adapted the manuscript to the style requirements.

2. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information regarding the experiments involving animals and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering.

As requested, we have added additional information to the Methods section.

3. Thank you for stating the following in the Competing Interests section:

[K.H. is a consultant for Dania Therapeutics Aps and a scientific advisor for Hannibal Health Innovation. The other authors declare no competing interests.].

Please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials, by including the following statement: ""This does not alter our adherence to PLOS ONE policies on sharing data and materials." (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests). If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.

Please include your updated Competing Interests statement in your cover letter; we will change the online submission form on your behalf.

We have added additional information to the Competing Interests section.

The competing Interests statement now reads:

K.H. is a consultant for Dania Therapeutics Aps and a scientific advisor for Hannibal Health Innovation. This does not alter our adherence to PLOS ONE policies on sharing data and materials. The other authors declare no competing interests.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission's figures or Supporting Information files. This policy and the journal's other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

We have included Supporting Information that include the original underlying images for DNA agarose gels and Western blot.

5. We note that Figure 1A, 1E, 2A and 2E in your submission contain copyrighted images. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:

a. You may seek permission from the original copyright holder of Figure 1A, 1E, 2A and 2E to publish the content specifically under the CC BY 4.0 license.

We have an academic license from Biorender that gives us the permission to use the figures in academic publications (https://www.biorender.com/academic-license). We have acknowledged Biorender as a source in the appropriate figures.

Response to Reviewers

Reviewer #1:

In Figure 1, we propose that both Riok2fl/fl; Rosa26::CreERT2 and Riok2fl/+; Rosa26::CreERT2 have the effect of downregulating RIOK2 gene expression. Why was Riok2+/+; Rosa26::CreERT2 mice not used as a control?

Heterozygous deletion of Riok2 does not influence mature hematopoietic cells in our competitive transplants. Figure 1B shows that the CD45.1:CD45.2 ratio is stable across all timepoints and for all cell types in the Riok2fl/+ competitive experiments. Additionally, as shown in Figure 1 D and E, we do not observe differences in mouse survival and bone marrow composition upon loss of one allele of Riok2 compared to wild-type mice. Therefore, we used Riok2fl/+ as a control for the effect of deleting both alleles of Riok2.

In Supplementary Figure 1, should there be additional images demonstrating the efficiency of RIOK2 gene knockdown in Riok2fl/fl; Rosa26::CreERT2 and Riok2fl/+; Rosa26::CreERT2 mice, rather than solely relying on DNA-level identification?

We agree with the reviewer that it would be nice to show. However, unfortunately, it is not possible to obtain enough cells to perform immunoblotting of RIOK2 on material from the competitive transplant, because the RIOK2 knockout cells were rapidly outcompeted by the non-recombined wild-type cells. Importantly, we have shown in supplemental Figure 2A that tamoxifen treatment leads to a rapid and efficient depletion of RIOK2 protein on hematopoietic stem- and progenitor cells, supporting the efficiency of the deletion of both alleles of Riok2.

In Figure 2, the experimental data regarding the impact of Riok2 knockout on HSC proliferation and differentiation is insufficient to support the authors' conclusions. Are there additional evidence available to substantiate these claims?

We agree with the author that the claims were insufficient and have removed the model that concluded independent mechanisms and a differentiation block for hematopoietic stem- and progenitor cells and mature cells.

Reviewer #2:

The figures included in the main text are of such low quality that it is difficult to discern the text within the images. Enhancement of image clarity is necessary.

We are sorry for this. The link provided in the downloaded pdf of the manuscript should have provided a high-resolution TIFF file of each of the figures. We have ensured that the figures in the revised version agree with the requirement of the journal.

Minor Points:

In Fig S1C, concerning the lower image of genotyping, it is unclear what the genotype is for the control. Why do two lanes of ctrl display mismatched bands?

The control bands are a negative (wild-type) control, which is the non-recombined locus as well as a positive (Riok2fl/fl) control. We have added additional description to the supplemental Figure 1C and its figure legend to enhance clarity.

2. Is it critical to establish the baseline levels of CD45.1 and CD45.2 in mice before the transplantation process? Additionally, would it enhance clarity to more distinctly show the reduction of CD45+ cells following radiation?

We have used appropriate controls to correctly set up the FACS gates for determination of CD45.1 and CD45.2 levels. In competitive transplantation it is not common practise to establish baseline levels. The assay is to establish the competition and not the total levels of each population.

3. Some of the statistical charts, like those in Figure 1B, 1C, and FigS1D, would benefit from an analysis of significance to support the findings.

We have performed additional statistical analyses for the figures requested by the reviewer and added appropriate descriptions to the figures and figure legends.

Attachment

Submitted filename: Response to Reviewers.docx

Decision Letter 1

Han Jimin Academic Editor

4 Mar 2024

RIO-kinase 2 is essential for hematopoiesis

PONE-D-23-40786R1

Dear Dr. Helin,

This time the authors have corrected it in such detail that I think PLOS ONE is ready to accept the paper.I asked the Reviewer to review it, and none of them had any opinion.I firmly believe that this article will contribute to the advancement of this field.

We're pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you'll receive an e-mail detailing the required amendments. When these have been addressed, you'll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they'll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Jimin Han

Academic Editor

PLOS ONE

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the "Comments to the Author" section, enter your conflict of interest statement in the "Confidential to Editor" section, and submit your "Accept" recommendation.

Reviewer #3: All comments have been addressed

***

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #3: Yes

***

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #3: Yes

***

4. Have the authors made all data underlying the findings in their manuscript fully available?

The http://www.plosone.org/static/policies.action#sharing requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #3: Yes

***

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #3: Yes

***

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #3: (No Response)

***

7. PLOS authors have the option to publish the peer review history of their article (https://journals.plos.org/plosone/s/editorial-and-peer-review-process#loc-peer-review-history). If published, this will include your full peer review and any attached files.

If you choose "no", your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our https://www.plos.org/privacy-policy.

Reviewer #3: No

***

Acceptance letter

Han Jimin Academic Editor

23 Mar 2024

PONE-D-23-40786R1

PLOS ONE

Dear Dr. Helin,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Jimin Han

Academic Editor

PLOS ONE

We thank members of the Helin Lab for discussions and Mafalda Araujo Pereira for suggestions for the FACS analysis. Figs 1A and 2A were created with Biorender.com.

1 K.H. is a consultant for Dania Therapeutics Aps and a scientific advisor for Hannibal Health Innovation. This does not alter our adherence to PLOS ONE policies on sharing data and materials. The other authors declare no competing interests. Signer RAJ, Magee JA, Salic A, Morrison SJ. Haematopoietic stem cells require a highly regulated protein synthesis rate. Nature. (2014); 508: 49–54. doi: 10.1038/nature13035, 24670665 2 Khajuria RK, Munschauer M, Ulirsch JC, Fiorini C, Ludwig LS, McFarland SK, et al. Ribosome Levels Selectively Regulate Translation and Lineage Commitment in Human Hematopoiesis. Cell. (2018); 173: 90–103.e19. doi: 10.1016/j.cell.2018.02.036, 29551269 3 Kressler D, Hurt E, Baßler J. Driving ribosome assembly. Biochim Biophys Acta ‐ Mol Cell Res. (2010); 1803: 673–683. doi: 10.1016/j.bbamcr.2009.10.009, 19879902 4 Ebert BL, Pretz J, Bosco J, Chang CY, Tamayo P, Galili N, et al. Identification of RPS14 as a 5q- syndrome gene by RNA interference screen. Nature. (2008); 451: 335–339. doi: 10.1038/nature06494, 18202658 5 Zemp I, Wild T, O'Donohue MF, Wandrey F, Widmann B, Gleizes PE, et al. Distinct cytoplasmic maturation steps of 40S ribosomal subunit precursors require hRio2. J Cell Biol. (2009); 185: 1167–1180. doi: 10.1083/jcb.200904048, 19564402 6 Ferreira-Cerca S, Sagar V, Schäfer T, Diop M, Wesseling AM, Lu H, et al. ATPase-dependent role of the atypical kinase Rio2 on the evolving pre-40S ribosomal subunit. Nat Struct Mol Biol. (2012); 19: 1316–1323. doi: 10.1038/nsmb.2403, 23104056 7 Raundhal M, Ghosh S, Myers SA, Cuoco MS, Singer M, Carr SA, et al. Blockade of IL-22 signaling reverses erythroid dysfunction in stress-induced anemias. Nat Immunol 2021 224. (2021); 22: 520–529. doi: 10.1038/s41590-021-00895-4, 33753942 8 Liu K, Chen H-L, Wang S, Gu M-M, Chen X-M, Zhang S-L, et al. High Expression of RIOK2 and NOB1 Predict Human Non-small Cell Lung Cancer Outcomes. Sci Rep. (2016); 6: 28666. doi: 10.1038/srep28666, 27346559 9 Read RD, Fenton TR, Gomez GG, Wykosky J, Vandenberg SR, Babic I, et al. A Kinome-Wide RNAi Screen in Drosophila Glia Reveals That the RIO Kinases Mediate Cell Proliferation and Survival through TORC2-Akt Signaling in Glioblastoma. PLoS Genet. (2013);9. doi: 10.1371/journal.pgen.1003253, 23459592 Ghosh S, Raundhal M, Myers SA, Carr SA, Chen X, Petsko GA, et al. Identification of RIOK2 as a master regulator of human blood cell development. Nat Immunol 2021 231. (2021); 23: 109–121. doi: 10.1038/s41590-021-01079-w, 34937919 Messling J-E, Agger K, Andersen KL, Kromer K, Kuepper HM, Lund AH, et al. Targeting RIOK2 ATPase activity leads to decreased protein synthesis and cell death in acute myeloid leukemia. Blood. (2021). doi: 10.1182/BLOOD.2021012629, 34359076 Bogoevski K, Woloszyk A, Blackwood K, Woodruff MA, Glatt V. Tissue Morphology and Antigenicity in Mouse and Rat Tibia: Comparing 12 Different Decalcification Conditions. J Histochem Cytochem. (2019); 67: 545. doi: 10.1369/0022155419850099, 31090479 Madisen L, Zwingman TA, Sunkin SM, Oh SW, Zariwala HA, Gu H, et al. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat Neurosci 2009 131. (2009); 13: 133–140. doi: 10.1038/nn.2467, 20023653 Hilton J, Gelmon K, Bedard PL, Tu D, Xu H, Tinker A V., et al. Results of the phase I CCTG IND.231 trial of CX-5461 in patients with advanced solid tumors enriched for DNA-repair deficiencies. Nat Commun 2022 131. (2022); 13: 1–12. doi: 10.1038/s41467-022-31199-2, 35750695

By Jan-Erik Messling; Isabel Peña-Rømer; Ann Sophie Moroni; Sarah Bruestl and Kristian Helin

Reported by Author; Author; Author; Author; Author