Background: The current study was conducted to evaluate the protective effect of Lavandula stoechas essential oils (LSEO) against malathion (M) exposure-caused reprotoxicity in male mice as well as the possible mechanisms implicated in such protection. Methods: Six–eight-week-old male mice weighting 25–30 g were used and divided into four groups: normal-control, LSEO (50 mg/kg, b.w.), malathion (200 mg/kg, b.w.) and malathion + LSEO treated mice. Malathion was emulsioned in corn oil and per orally administered for 30 days. LSEO was daily administrated during the same period. LSEO chemical identification was done by Gas chromatography–mass spectrometry (GC-MS). Reproduction-damages and LSEO-benefits were assessed using histopathological, biochemical and steroidogenesis gene expression disruptions and improvements. Results: The GC-MS analysis, allowed to the identification of 25 bioactive compounds in MCEO. In vivo, we firstly found that malathion exposure induced a clear reprotoxicity as assessed by a significant-decrease (P < 0.05) of testis/epididymis relative weights, serum testosterone level and reproductive performance. Malathion also produced lipoperoxidation, thiol (-SH) groups decrease as well as a significant-depletion (P < 0.05) of antioxidant enzyme activities such as catalase (CAT) and glutathione peroxidase (GPx), total superoxide dismutase (SOD), Cu/Zn-SOD and Mn-SOD in testis and epididymis. The histopathological examination showed marked change in both studied tissues. All these biochemical and structural changes were significantly (P < 0.05) corrected by LSEO co-administration. More importantly, malathion exposure remarkably (P < 0.05) down-regulated the expression of StAR gene as well as, the mRNA levels of P450scc, 3ßHSD and 17ß-HSD, while LSEO-administration strangely protected against steroidogenesis disruption. Conclusions: The potential protective effects of LSEO against malathion-induced reprotoxicity and oxidative stress might be partially to its antioxidant properties as well as its opposite effect against some gene expression involved in the steroidogenesis.
Keywords: Malathion; Mice; Steroidogenesis; LSEO; Oxidative stress; StAR gene
Some organophosphorus (OPs) compounds are known by their effects on impair fertility, suppressif libido, causif testicular degeneration, and deterioration in semen quality [[
Lavandula stoechas is a well identified medicinal plant species in the word, including Tunisia. However, due to its high content in therapeutically active compounds, this plant presents many beneficial health properties in part due to its antioxidant and anti-inflammatory actions [[
In our knowledge, the toxicity of malathion on testicular Leydig cell function is still unknowned. Therefore, in the current study we intended to investigate the action of a sub-chronic exposure of male mice to malathion on Leydig cell steroidogenesis, free radicals production as well as StAR, P450 scc, 3β-HSD and 17β-HSD genes expression. In addition, this study aims also to investigate the protective effect of Lavandula stoechas essential oils (LSEO) against all damages induced by this insecticide as well as the mechanisms involved in this protection.
Malathion (Fyfanon EC 500) was obtained from INNOVA Society size in Tunis, Tunisia at The purity of 96%. 2-Thio-barbituric acid (TBA), bovine catalase, Epinephrine, and butylated hydroxytoluene (BHT) were from Sigma aldrich chemicals Co (Germany). All other chemicals used were of analytical grade.
The aerial parts of Lavandula stoechas were collected from the area of Ain-Draham (North-West of Tunisia) and identified in laboratory of taxonomy in the Faculty of Sciences of Tunis (FST)-Tunisia. The Voucher specimens (No. L101) have been deposited with the herbarium of the Higher Institute of Biotechnology of Beja, Tunisia.
Plant extracts preparation was performed according as describe by Selmi et al. [[
The essential oils of L. stoechas were subjected to GC-MS analysis using Trace GC ULTRA /Polaris Q (GC-MS, Thermo Electron) as described by Sebai et al. with a slight modifications [[
Adult male mice (25–30 g) and were cared for in compliance with the code of practice for the Care and Use of Animals for Scientific Purposes. Approval for these experiments was obtained from the Medical Ethical Committee for the Care and Use of Laboratory Animals of Pasteur Institute of Tunis (approval number: LNFP/Pro 152,012). The experimental protocols were approved by the Faculty Ethics Committee (Faculty of Sciences, Tunis, Tunisia). The animals were housed in standard cages (40 × 28 × 16 cm) under controlled conditions: 12:12-h light:dark, 20–22 °C, food and water are ad libitum. Mice were after divided into 4 groups of 12 animals in each:
Group I (CTR): animals served as control and received equivalent volume of corn oil (1 ml), group II (M): animals were treated with malathion at 200 mg/kg body weight/day dissolved in 1 ml of corn oil, group III (LSEO): animals received Lavandula stoechas essential oils (50 mg/kg b.w.) and group IV (M + LSEO): animals received both malathion and LSEO under the same conditions.
Initial (weight at the starting point) and final (weight at the end point) body weights were recorded. Testis and epididymis were stripped from fatty tissues and blood vessels, blotted, and their absolute weights were determined. Clinical signs of body and reproductive organs were evaluated for toxicological criteria. To normalize the data for statistical analysis and to obtain relative weight, data were expressed per 100 g body weight.
Serum testosterone level was quantified by enzyme-linked immunosorbent assay (ELISA) using specific commercial kits (DEMEDITEC Diagnostics GmbH, Germany). Data were determined according to the manufacturer's protocols as described by Selmi et al. [[
Sperm collection was performed as described by Selmi et al. [[
The cauda epididymal sperm count, motility, viability and morphology was performed as described by Selmi et al. [[
RNA extraction and RT-PCR Total RNA from rat testis was isolated with RNeasy Mini Kit (ambion by Life Technology) according to the manufacturer's protocol as described by Selmi et al. [[
Lipid peroxidation was detected by the determination of MDA content as described by the method of Buege and Aust [[
Total Thiol groups concentration (-SH) was performed according to Ellman method with slight modifications [[
Determination of SOD activity was performed according of Misra and Fridovich with slight modifications [[
CAT activity was assayed according to Aebi with slight modifications [[
GPx activity was determined according to Flohé and Günzler [[
Protein content in the testis and epididymis was determined by the method of Bradford using bovine serum albumin (BSA) as standard [[
Histopathological examination in testis and epididymis tissues was performed by the method described by Selmi et al. [[
The data were analyzed by unpaired t-student test and were expressed as means ± standard error of the mean (S.E.M.). The data are representative of 12 independent experiments. All statistical tests were two-tailed, and a p value of 0.05 or less was considered significant.
L. stoechas essential-oil bioactive-compounds were identified by the GC–MS technique and presented in Table 1. In this respect, thirty-two compounds have been identified. The main components are: D-Fenchone (29.28%), α-pinene (23.18%) and camphor (15.97%). These cyclic compounds belong essentially to the family of oxygenated monoterpenes known for their antioxidant and free radical scavengers.
L. stoechas essential-oil phytochemical composition identified using a GC–MS analyze
No Components IR Compositions (%) 1 Tricyclene 6.137 0.51 2 α-pinene 6.720 23.18 3 Camphene 7.310 7.83 4 β-Phellandrene 8.500 0.10 5 β -Pinene 8.626 0.12 6 Delta 3-Carene 10.554 0.11 7 Cymene 11.504 0.72 8 Limonene 11.807 2.71 9 Eucapur 11.893 3.29 10 D-Fenchone 15.835 29.28 11 Linalool 16.785 2.01 12 Camphor 19.526 15.97 13 Myrtenol 23.228 0.26 14 Endobornyl Acetate 29.122 1.03 15 Aromad Endrene 33.991 0.28 16 α -Copaene 34.809 0.28 17 Caryophyllene 37.436 0.26 18 β -Selinene 41.533 0.26 19 Delta-Cadinene 43.953 0.67 20 α -Elemene 44.434 0.12 21 Selina-3,7(11)-diene 44.817 0.85 22 Delta-gurjunene 47.730 0.20
IR Retention Index
Data from Table 2, showed that sub-chronic exposure of male mice to malathion-induced a significant decrease (P < 0.05) of testis/epididymis relative-weights. Indeed, these last were reduced from 0.52 ± 0.01 to 0.63 ± 0.06 and from 0.09 ± 0.01 to 0.12 ± 0.02 in malathion-treated-group respectively. However, LSEO pre-treatment significantly (P < 0.05) protected against malathion-caused reproductive organs weight loss.
Effect of sub-chronic treatment (30 days) malathion (200 mg / kg BW, po) and / or essential oils of lavender (50 mg / kg, PC, OP) on relative weight of testis and epididymis in male mice
Parameters CTR M LSEO M + LSEO Testis relative weight (g/100 g b.w) 0.52 ± 0.01 0.63 ± 0.06* 0.54 ± 0.04# 0.49 ± 0.02# Epididymis relative weight (g/100 g b.w) 0.09 ± 0.01 0.12 ± 0.02* 0.09 ± 0.02# 0.1 ± 0.02#
The results represent the mean ± SEM (n = 12). (*: P < 0.05 vs. control, and #: P < 0.05 vs malathion-group by the student-test)
Data from Fig. 1, showed that sub-chronic exposure of male mice to malathion-induced a significant diminution (P < 0.05) of serum testosterone level in all treated-groups. In contrast, the Co-administration of malathion and LSEO had no effect on the testosterone level.
Graph: Fig. 1 Subchronic effect (30 days) of malathion (200 mg / kg BW, po) and / or lavender essential oils (LSEO) (50 mg / kg, PC, OP) on testosterone levels in male mice. Values are expressed as mean ± SEM(n = 12). * Comparison of CTR and other groups (p 0.05). # Comparison of M with LSEO group (p 0.05)
Data from Table 3, showed that 30 days exposure to malathion-provoked a significant depletion (P < 0.05) of different sperm parameters such as epididymal sperm concentration (7.36 ± 2.00 to 2.76 ± 1.00 10
Effect of sub-chronic treatment (30 days) malathion (200 mg / kg BW, po) and / or essential oils of lavender (50 mg / kg, PC, OP) on variation in the sperm parameters in male-mice
Parameters CTR M LSEO M + LSEO Sperm concentration (106/mL) 7.36 ± 2.00 2.76 ± 1.00* 7.89 ± 1.00# 7.21 ± 2.00# Motility (%) 69.00 ± 7.00 40.00 ± 5.00* 68.00 ± 4.00# 67.00 ± 5.00# Viability (%) 79.00 ± 4.00 22.00 ± 6.00* 81.00 ± 4.00# 72.00 ± 5.00# Morphology (normal form) (%) 86.10 ± 4.52 46.00 ± 3.00* 89.00 ± 4.56# 79.00 ± 5.38# Head Abnormal sperm (%) 5.80 ± 0.96 14.00 ± 2.10* 4.62 ± 1.12# 6.49 ± 1.71# Caudal Abnormal sperm (%) 8.10 ± 1.41 39.00 ± 4.20* 11.60 ± 2.30# 15.80 ± 1.90# Sperm count 106/g epididymis 132.00 ± 16.40 96.00 ± 1.98* 134.00 ± 1.96# 123.00 ± 3.49# Spermatid count 106/g of testis 200.00 ± 9.30 118.00 ± 5.89* 189.00 ± 7.21# 183.00 ± 8.78#
The results represent the mean ± SEM (n = 12). (*: P < 0.05 vs. control, and #: P < 0.05 vs Malathion by the student t-test)
Graph: Fig. 2 Determination of sperm viability by flow cytometry using propidium iodide (PI) as a probe. a Chart type obtained with the cytometer shows the dispersion of the cells according to their fluorescence (FL3) and size (FSC). The fluorescence threshold is indicated, the red dots placed above this threshold represent the fluorescent cells. b The percentage of fluorescent sperm is then determined by the software and averages are calculated is presented as a histogram (n = 6). ** P < 0.01 Control vs Malathion
Graph: Fig. 3 Determination of spermatic thiols groups by flow cytometry using monobromobimane (MB) as a probe. a Chart type obtained with the cytometer shows the dispersion of the cells according to their fluorescence (FL3) and size (FSC). The fluorescence threshold is indicated, the red dots placed above this threshold represent the fluorescent cells. b The percentage of fluorescent sperm is then determined by the software and averages are calculated is presented as a histogram (n = 6). ** P < 0.01 Control vs Malathion
Graph: Fig. 4 Determination of spermatic DNA decompaction by flow cytometry using chromomycine A3 (CMA3) as a probe. a Chart type obtained with the cytometer shows the dispersion of the cells according to their fluorescence (FL3) and size (FSC). The fluorescence threshold is indicated, the red dots placed above this threshold represent the fluorescent cells. b The percentage of fluorescent sperm is then determined by the software and averages are calculated is presented as a histogram (n = 6). ** P < 0.01 Control vs Malathion
Morphological abnormalities of spermatozoa were evaluated based on head or tail forms. LSEO co-administration (50 mg/kg) to male mice intoxicated with malathion at a dose of 200 mg/kg leads to a restoration of all male-fertility-parameters and reduce abnormal spermatozoa forms and the results were comparable to those experimental in the normal-animals.
We further looked at the effect of malathion (200 mg kg, b.w.) exposure during 30 days on StAR protein gene-expression responsible for cholesterol transport as well as steroidogenic enzymes P450scc, 3ßHSD, and 17ß-HSD. The expression levels were normalized by β-actin expression detected in the same PCR reaction, and these values were compared with those of the control group. As expected, there was no change in the expression of β-actin in control and treated groups. However, malathion exposure caused a singnificant-decrease (P < 0.05) in both StAR, P450scc, 3ßHSD, and 17ß-HSD when compared to control group. In opposite, LSEO co-administration of had no effect on steroidogenesis gene expression (Table 4 and Fig. 5).
Primers used for RT-PCR
Primer Primer Sequence (5′-3′) Tm (°c) StAR Forward: GCCCCGAGACTTCGTAAG Reverse: CAGGTGGGACCGTGTTCA 59 P450scc Forward: GCCCCGAGACTTCGTAAG Reverse: CAGGTGGGACCGTGTTCA 60 3β-HSD Forward: CCTGCTGCGTCCATTTTA Reverse: TCTGCTTGGCTTCCTCCC 60 17β-HSD Forward: ACCGCCGATGAGTTTGTT Reverse: GGGTGGTGCTGCTGTAGA 60 β-Actin Forward: GAGATTACTGCCCTGGCTCCTA Reverse: ACTCATCGTACTCCTGCTTGCTG 60
Graph: Fig. 5 Evaluation of mRNA expressions of enzymes and proteins involved in steroidogenesis.Values are expressed as mean ± SEM(n = 12). * Comparison of CTR and other groups (p 0.05). # Comparison of M with LSEO group (p 0.05)
To assess the effect of the organophosphorus compound and essential-oils on oxidative stress situation, the some antioxidant biomarkers were evaluated in the different groups. Results showed that oxidative-stress induced by malathion-treatment is explained by a significant increase (P < 0.05) of lipoperoxydation in testis and epididymis, hydrogen peroxide production (P < 0.05) as well as a decrease (P < 0.05) of thiol groups content (Tables 5, 6 and 7). However, the treatment of animals with LSEO protects against all these alterations caused by malathion-intoxication. On another hand, we examined the antioxidant-enzyme-activities in testis and epididymis (Tables 8, 9, 10 and 11). As expected, malathion-intoxication induced a significantly (P < 0.05) reduce of CAT, GPx, total SOD and SOD isoforms such as Cu/Zn-SOD and Mn-SOD activities. The sub-chronic co-administration of LSEO markedly (P < 0.05) protected against the depletion of testis/epididymis antioxidant enzyme activities induced by malathion exposure during 30 days.
Effect of sub-chronic treatment (30 days) malathion (200 mg / kg BW, po) and / or essential oils of lavender (50 mg / kg, PC, OP) on variation of MDA levels on testis and epididymis of male mice
MDA (nmol/mg protein) CTR M LSEO M + LSEO Testis 3.80 ± 0.37 6.20 ± 0.35* 3.60 ± 0.34 4.10 ± 0.22# Epididymis 3.20 ± 0.28 5.30 ± 0.46* 3.20 ± 0.14# 3.50 ± 0.18#
The results represent the mean ± SEM (n = 12). (*: P < 0.05 vs. control, and #: p < 0.05 vs Malathion by the student t-test)
Effect of a sub-chronic treatment (30 days) by malathion (200 mg / kg BW, po) and / or essential oils of lavender (50 mg / kg, PC, OP) on thiols groups level of the testis and epididymis in male mice
-SH (nmol/mg of protein) CTR M LSEO M + LSEO Testis 0.89 ± 0.04 0.58 ± 0.03* 0.87 ± 0.04# 0.76 ± 0.03# Epididymis 0.36 ± 0.02 0.26 ± 0.02* 0.37 ± 0.02# 0.37 ± 0.02#
The results represent the mean ± SEM (n = 12). (*: P < 0.05 vs. control, and #: p < 0.05 vs Malathion by the student t-test)
Effect of sub-chronic treatment (30 days) malathion (200 mg / kg BW, po) and / or essential oils of lavender (50 mg / kg, PC, OP) on variation of the rate of hydrogen peroxide (H 2 O 2) in testis and epididymis in male mice
H2O2 (μmol/mg proteins) CTR M LSEO M + LSEO Testis 0.84 ± 0.07 1.78 ± 0.06* 0.88 ± 0.08# 0.96 ± 0.06# Epididymis 0.69 ± 0.06 1.23 ± 0.05* 0.63 ± 0.06# 0.89 ± 0.02*#
The results represent the mean ± SEM (n = 12). (*: P < 0.05 vs. control, and #: p < 0.05 vs Malathion by the student t-test)
Effect of sub-chronic treatment (30 days) malathion (200 mg / kg BW, po) and / or essential oils of lavender (50 mg / kg, PC, OP) on catalase (CAT) activity of levels in testis and epididymis in mice
Catalase (nmol min− 1 mg− 1 proteins) CTR M LSEO M + LSEO Testis 563.00 ± 37.40 246.00 ± 23.90* 578.00 ± 28.50*# 594.00 ± 36.20# Epididymis 193.00 ± 19.80 98.00 ± 17.60* 196.00 ± 25.40# 162.00 ± 22.70*#
The results represent the mean ± SEM (n = 12). (*: P < 0.05 vs. control, and #: p < 0.05 vs Malathion by the student t-test)
Effect of sub-chronic treatment (30 days) malathion (200 mg / kg BW, po) and / or essential oils of lavender (50 mg / kg, PC, OP) on glutathione peroxidase (GPx) activity of testis and epididymis in mice
GPx (GSH consumed/min/mg protein) CTR M LSEO M + LSEO Testis 9.20 ± 0.90 4.70 ± 0.5°* 9.60 ± 0.45# 8.20 ± 0.47# Epididymis 7.50 ± 0.50 3.30 ± 0.60* 7.70 ± 0.20# 6.70 ± 0.42#
The results represent the mean ± SEM (n = 12). (*: P < 0.05 vs. control, and #: p < 0.05 vs Malathion by the student t-test)
Effect of sub-chronic treatment (30 days) malathion (200 mg / kg BW, po) and / or essential oils of lavender (50 mg / kg, PC, OP) on variation in the activity of superoxide dismutase (SOD) total (U of SOD activity per mg proteins), Cu / Zn SOD, Mn-SOD and Fe-SOD in the testes in mice
Testis SOD CTR M LSEO M + LSEO SOD Total 8.34 ± 0.67 4.48 ± 0.42* 8.43 ± 0.38# 6.89 ± 0.51*# cu/zn-SOD 4.36 ± 0.45 2.23 ± 0.24* 4.97 ± 0.41# 4.09 ± 0.3# Mn-SOD 2.49 ± 0.36 1.47 ± 0.15* 2.56 ± 0.13# 1.63 ± 0.27* Fe-SOD 1.14 ± 0.13 1.09 ± 0.18 1.16 ± 0.22 1.18 ± 0.12
The results represent the mean ± SEM (n = 12). (*: P < 0.05 vs. control, and #: p < 0.05 vs Malathion by the student t-test)
Effect of sub-chronic treatment (30 days) malathion (200 mg / kg BW, po) and / or essential oils of lavender (50 mg / kg, PC, OP) on variation in the activity of superoxide dismutase (SOD) total (U of SOD activity per mg proteins), Cu / Zn SOD, Mn-SOD and Fe-SOD in the epididymis in mice
Epididymis SOD CTR M LSEO M + LSEO SOD Total 6.67 ± 0.47 3.56 ± 0.28* 6.63 ± 0.38# 6.29 ± 0.51# cu/zn-SOD 3.91 ± 0.22 1.21 ± 0.22* 3.64 ± 0.23# 3.82 ± 0.12# Mn-SOD 1.62 ± 0.16 1.42 ± 0.21* 1.66 ± 0.11# 1.69 ± 0.09# Fe-SOD 0.78 ± 0.07 0.71 ± 0.05 0.74 ± 0.06 0.76 ± 0.04
The results represent the mean ± SEM (n = 12). (*: P < 0.05 vs. control, and #: p < 0.05 vs Malathion by the student t-test)
Histological organization of the testis is illustrated in Fig. 6. Testis of undamaged control (Fig. 6a) showed regular seminiferous tubules lined with germinal epithelial layer. Different types of spermatogenic, cells appeared in their ordinary form with: spermatogonia, primary and secondary spermatocytes, spermatids and mature spermatozoa. Sertoli and Leydig cells with standard form were observed. Leydig cells and blood vessels were found in the interstitial connective tissues between the seminiferous tubules, and the tubules which appeared with regular size and shape. Malathion exposure (Fig. 6b) caused necrosis, deterioration, diminishing the number of spermatogenic cells in seminiferous tubules, unscrambling of cells from basal region of seminiferous tubules and loss the Leydig cells in interstitial tissue. LSEO Co-administrated to malathion protected and recovered the damages of testicular tissues, induced by the malathion intoxication. On the other hand, concerning the histomorphology of epididymis, we showed that malathion exposure caused a loss of sperm from the lumen of epididymis as well as the disintegration of basal membrane (Fig. 7b), whereas the co-treatment with LSEO restored the architecture of epididymis as evidenced by the accumulation of sperm in the centre of lumen and the regeneration of lining cells (Fig. 7c and d).
Graph: Fig. 6 Histological changes induced by subchronic malathion exposure (200 mg/kg/b.w., p.o.) during 30 days (b), Normal architecture in control group (a), LSEO group (c) and coadministration of M+ LSEO (d); (X400). L: leidigs cells; I: Interstitial space; Sg: Spermatogonia; Sd: Spermatid; S: Spermatozoa; *: decrease of spermatozoa density
Graph: Fig. 7 Histomorphology of epididymis observed under light microscope (400 magnification). (a) Control, (b) Malathion treated, (c) LSEO, (d) M + LSEO. : Lumen of the epididymis.: Basal epithelial membrane
Firstly, the chemical analysis using GC-MS technique allowed to the identification of 22 compounds. In vivo part study, we showed that the subchronic-exposure to malathion leads to a significant decline of testis/epididymis relative weights indicating a testicular deterioration. Added to that, our results showed a marked decrease in serum testosterone levels in male mice after chemical intoxication. These alterations were accompanied with a concomitant decrease in the mRNA level of the genes involved in the transport and transfer of cholesterol and steroidogenesis, including that of the StAR protein, P450scc, 3β-HSD and 17β-HSD, was observed in contrast to an increase in the total cholesterol level of the same group. More importantly, we showed in this study, a significative-diminution in mRNA expression of StAR, P450scc, 3ßHSD, and 17ß-HSD was detected after malathion-exposure, while, LSEO co-administration extensively ameliorated the mRNA expression of studied genes. We also studied the effect of coadministration of malathion and LSEO on oxidative stress parameters. In this context, we showed that malathion-administration induced oxidative stress as assessed by an increase of lipid peroxidation and hydrogen peroxide level, a decrease of sulfhydrils content, as well as a depletion of antioxidant enzyme activities such as CAT, GPx, total SOD, Cu/Zn-SOD, Mn-SOD, and Fe-SOD in testis and epididymis. All these alterations were associated with histopathological changes in both reproductive-organs.
Testis weight is principally dependent on the mass of the differentiated spermatogenic cells; the lessening in its weight may be due to decreased number of germ cells, inhibition of spermatogenesis, and steroidogenesis [[
Since testicular Leydig cells are the site of synthesis of male steroid hormone. This hormone also plays a key role in the conservation of male sexual characteristics, spermatogenesis and fertility [[
However, the conversion of cholesterol to testosterone in Leydig cells, the cholesterol is done in several stages and is under the action of different enzymes for each [[
The decrease in mRNA expression of StAR, P450scc, 3ßHSD, and 17ß-HSD are previously shown to be responsible for cholesterol transport and testosterone synthesis in mice and rat testis [[
As soon as it reaches the inner mitochondrial membrane, cholesterol and under the action of a key enzyme regulating steroidogenesis P450scc to produce pregnenolone [[
On the other hand, 3ß-HSD and 17ß-HSD, enzymes which can play a crucial role in testosterone biosynthesis. 3ß-HSD convert's pregnenolone to progesterone, 17 hydroxypregnenolone to 17-hydroxyprogesterone (17-OHP), dehydroepiandrosterone (DHEA) to androstenedione, 17 ßHSD transformed androstenedione to testosterone in the smooth endoplasmic reticulum. A singnificant reduction of activity and expression these enzymes were also noted in malathion-treated mice compared to control group. In part, this reduction of 3ß-HSD and 17ß-HSD gene expression indicates a possible role of these genes to reduce testosterone level in male mice following malathion exposure, and in the other part, may be due also to the diminished expression of StAR. [[
We have been previously reported in our later studies that malathion induced oxidative stress in many organ systems such as liver [[
On the other hand, using the DPPH radical-scavenging assay we showed that L. stoechas essential oils had an elevated scavenging capacity which may be correlated to the existence of phenolic compounds [[
Injury of cell DNA induced by ROS production led to the formation of some peroxidation products such as 8-oxo-7,8 dihydroxyguanosine, which cause disintegration and have a mutagenic consequence [[
We have evidently established that LSEO protect in opposition to malathion-induced steroidogenesis disruptions and oxidative stress in the reproductive function. This repro-protection offered by LSEO may be correlated in part to its antioxidant properties. This research supports the therapeutic potential of LSEO for prevention/treatment of reproductive-toxicity and should be further explored in clinical studies.
SS coordinated data collection, carried out the analyses, drafted the initial manuscript, and approved the final manuscript as submitted, conceptualized and designed the study. KR statistic analysis and participate to biochemical essays. DG participates to biochemical and molecular assays. OL participates to biochemical and molecular assays. HS developed the propagation model and calculated the exposure values, reviewed and revised the manuscript, and approved the final manuscript as submitted. LM conceptualized and designed the study, obtained funding, reviewed and revised the manuscript and approved the final manuscript as submitted.
Animals were cared for in compliance with the code of practice for the Care and Use of Animals for Scientific Purposes. Approval for these experiments was obtained from the Medical Ethical Committee for the Care and Use of Laboratory Animals of Pasteur Institute of Tunis (approval number: LNFP/Pro 152,012). The experimental protocols were approved by the Faculty Ethics Committee (Faculty of Sciences, Tunis, Tunisia).
This information is not relevant.
The authors declare that they have no competing interests.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Financial support of the Tunisian Ministry of Higher Education and Scientific Research is gratefully acknowledged. Financial disclosures: none declared.
The study was funded by Tunisian Ministry of Higher Education and Scientific Research.
All data and materials are contained and described within the manuscript.
By Slimen Selmi; Kais Rtibi; Dhekra Grami; Hichem Sebai and Lamjed Marzouki