Background: Schizophrenia is a severe neurodevelopmental disorder with a complex genetic and environmental etiology. Abnormal glutamate ionotropic N-methyl-D-aspartate receptor (NMDA) type subunit 1 (NR1) may be a potential cause of schizophrenia. Methods: We conducted a case-control study to investigate the association between the GRIN1 gene, which encodes the NR1 subunit, and the risk of schizophrenia in a northern Chinese Han population using Sanger DNA sequencing. The dual luciferase reporter assay was used to detect the influence of two different haplotypes on GRIN1 gene expression. Results: Seven SNPs (single nucleotide polymorphisms), including rs112421622 (− 2019 T/C), rs138961287 (− 1962--1961insT), rs117783907 (−1945G/T), rs181682830 (−1934G/A), rs7032504 (-1742C/T), rs144123109 (−1140G/A), and rs11146020 (−855G/C) were detected in the study population. Rs117783907 (−1945G/T) was associated with the occurrence of schizophrenia as a protective factor. The genotype frequencies of rs138961287 (− 1962--1961insT) and rs11146020 (−855G/C) were statistically different between cases and controls (p < 0.0083). The other four variations were not shown to be associated with the disease. Two haplotypes were composed of the seven SNPs, and distribution of T-del-G-G-C-G-G was significantly different between the case and control groups. However, the dual luciferase reporter assay showed that neither of the haplotypes affected luciferase expression in HEK-293 and SK-N-SH cell lines. Conclusions: The GRIN1 gene may be related to the occurrence of schizophrenia. Additional research will be needed to fully ascertain the role of GRIN1 in the etiology of schizophrenia.
Keywords: GRIN1, schizophrenia, association, polymorphism
Electronic supplementary material The online version of this article (10.1186/s12881-019-0757-3) contains supplementary material, which is available to authorized users.
Schizophrenia is a serious genetic disease characterized by emotional impairment, cognitive deficits, and social dysfunction [[
NMDA receptors are heterotetramers composed of two NR1 subunits and NR2 or/and NR3 subunits [[
The role of GRIN1 in the etiology of schizophrenia remains uncertain, and genetic association studies of the GRIN1 gene and schizophrenia in the northern Chinese Han population are relatively deficient. We conducted a case-control study to investigate the association between GRIN1 and the risk of schizophrenia in a northern Chinese Han population using Sanger DNA sequencing. Furthermore, the effects of two different haplotypes located in the 5′ promoter region of the GRIN1 gene on protein expression were detected by dual luciferase reporter assay.
Blood samples from 316 northern Han Chinese healthy unrelated volunteers (157 females, 159 males, mean age 44 ± 14.3) were provided by China Medical University. Questionnaires showed that there was no history of mental illness within three generations. Blood samples from 309 northern Han Chinese patients with schizophrenia (156 females, 153 males, average age 41 ± 14.6) were provided by the Third People's Hospital of Liaoning Province. The diagnosis of schizophrenia was in accordance with The Diagnostic and Statistical Manual of Mental Disorders (fourth edition). To confirm the diagnoses, two independent senior psychiatrists reviewed psychiatric medical records. Genomic DNA was extracted from peripheral blood by the standard phenol-chloroform method. The study was approved by the Ethics Committee of China Medical University, and written informed consent was obtained from each participant and/or patient guarantor.
Polymerase chain reaction (PCR) was used to amplify the GRIN1 fragment, including the 5′ flanking and untranslated regions. The nucleotide position of the target fragment amplified was from − 2334 to + 86 (with ATG + 1). Genomic DNA (1 μL, about 30 ng) was amplified under the following reaction contents: 1 μL (5 pmol) each of sense and antisense primers, 2 μL (3 nmol) of dNTP mix, 0.2 μL (about 0.5 U) of PrimeSTAR® HS DNA polymerase (Takara, Dalian, China) and 10 μL 2 × Prime STAR HS GC buffer. Sterilized deionized water was added to a volume of 20 μL. PCR cycling conditions were 94 °C for 1 min; 30 cycles at 98 °C for 10 s, at 60 °C for 5 s, and 72 °C for 2 min 30 s; and 72 °C for 10 min. PCR products were separated by 1% agarose gel electrophoresis.
DNA was sequenced using Sanger DNA sequencing (Taihe Biotechnology Co. Ltd. Beijing China). Primer information was shown in Table 1.
Primers used for GRIN1 gene sequencing
Primer name Annealing temperature (°C) Primer sequence (5′ → 3′) F (−2334 — -2313) 60 5' AGCTTGGGGACGCACATACGGT 3' R1 (+ 64 — + 86) 60 5' AATGTTGACGATCTTGGGGTCGC 3' R2 (− 700 — -676) – 5' GATCACCTGCCCGTACCCTGCTGCA 3' R3 (− 1515 — -1491) – 5' GTCGTCACCCACAGTCAGCGATATT 3'
F indicates the forward primer and R indicates the reverse primer. F and R1 are PCR amplification primers, and F, R1, R2, and R3 are Sanger sequencing primers. The position of the primer is in parentheses (with ATG + 1).
The target fragment located at − 2143 - + 222 (with ATG + 1) was amplified using a PrimerSTAR® kit (Takara, Dalian, China). The sense primer was 5' G
The two different haplotype pGM-T recombinant vectors were subcloned into the pGL-3 Basic Vector (Promega, Madison, Wisconsin, USA) using NheI or BglII.
Human embryonic kidney cell line HEK-293 and neuroblastoma cell line SK-N-SH were used to test luciferase activity of the pGL-3 recombinant vectors. HEK-293 cells were cultured in HyClone® DMEM high glucose medium with 10% fetal bovine serum (Thermo Fisher Scientific, Massachusetts, USA). SK-N-SH cells were cultured in KeyGRN BioTECH® DMEM high glucose medium (with 0.011 g/L sodium pyruvate) with 15% fetal bovine serum. Cells were seeded in 24-well plates (2 × 10
SPSS 20.0 software (IBM, Armonk, NY, USA) was used to analyze genotype frequency, allele frequency, haplotype frequency, and LUC/TK values (relative fluorescence intensity). Haploview 4.2 software (Broad Institute, Cambridge, MA, USA) was used for the Hardy–Weinberg equilibrium test and to confirm haplotypes. The χ2 test was used to examine the distribution of genotypes, alleles, and haplotypes between groups. The threshold for polymorphism multiple correction was p = 0.05/6, and the haplotype multiple test threshold after Bonferroni correction was 0.05/2. Independent sample T test was used to compare the relative fluorescence intensity of the two haplotypes. Relative fluorescence intensity was expressed as the mean ± standard deviation, and p < 0.05 (two sided) represented a significant difference. Power analysis was conducted using PS program [[
Seven common SNPs (Fig. 1), including rs112421622 (− 2019 T/C), rs138961287 (− 1962--1961insT), rs117783907 (−1945G/T), rs181682830 (−1934G/A), rs7032504 (-1742C/T), rs144123109 (−1140G/A) and rs11146020 (−855G/C), were detected in the 5′ promoter region of the GRIN1 gene in healthy Chinese Han individuals. The distribution of all seven SNPs was in accordance with Hardy-Weinberg equilibrium in the control group (p > 0.05). Results of linkage disequilibrium analysis using Haploview 4.2 software are presented in Fig. 2, showing that rs138961287 (− 1962 - -1961insT) and rs117783907 (−1945G/T) are in linkage disequilibrium (D' = 0.99, r2 = 0.94). Given that there were six independent SNPs, the threshold for polymorphism multiple correction was p = 0.05/6 = 0.0083.
Graph: Fig. 1 Schematic diagram of the distribution of seven SNP loci in the GRIN1 gene. The detailed position of the fragment used for Sanger DNA sequencing in the GRIN1 gene 5′ promoter region was located between − 2334 bp and + 86 bp. * denotes the SNP not included in the genetic association study because the minimum allele frequency was less than 0.01
Graph: Fig. 2 Linkage disequilibrium diagram of seven SNP loci in the GRIN1 gene. Left is D' in the control group, and the red grid represents D' = 1. Right is r 2 in the control group, and the black grid represents r 2 = 1
Both genotype and allele distribution (Additional file 1) of rs117783907 (−1945G/T) were significantly different between the case and control groups (p < 0.0083). The frequency of the T allele in rs117783907 (−1945G/T) in the case group (15.2%) was much lower than in the control group (21.7%). The genotype frequencies of rs138961287 (− 1962--1961insT) and rs11146020 (−855G/C) were statistically different between cases and controls (p < 0.0083). Rs112421622 (− 2019 T/C), rs181682830 (−1934G/A), rs7032504 (-1742C/T), and rs144123109 (−1140G/A) were detected only in two genotypes and were determined to be unrelated to schizophrenia. The power of (− 1962 - -1961insT), rs117783907 (−1945G/T), and rs11146020 (−855G/C) were all > 0.70, and the power of rs117783907 (−1945G/T) in particular reached 0.982 (Additional file 1). According to the GTEx database, the GRIN1 gene is highly expressed in brain tissue compared with other tissues (Fig. 3).
Graph: Fig. 3 GRIN1 gene expression in different tissues. TPM on the vertical axis represents the transcript quantification value, and the horizontal axis represents different tissues. The GRIN1 gene was highly expressed in brain tissue compared with other tissues
A total of seven SNPs formed six haplotypes, but after excluding four with very low frequencies (< 5%), only haplotypes T-del-G-G-C-G-G and T-insT-T-G-C-G-C remained. Therefore, the haplotype multiple test threshold after Bonferroni correction was 0.05/2 = 0.025. We found a significant difference in the haplotype frequency distribution of T-del-G-G-C-G-G between case and control groups (Additional file 2), with p values of 0.005. Specifically, the frequency of haplotype T-del-G-G-C-G-G in the case group (77.8%) was much higher than in the control group (70.9%), increasing the disease risk (OR = 1.442, 95% CI: 1.116–1.862). Haplotype T-insT-T-G-C-G-C was not related to schizophrenia.
Comparing the LUC/TK values of the two haplotypes (Fig. 4), we found that the relative fluorescence intensity of the recombinant vector T-del-G-G-C-G-G was higher than T-T-T-G-C-G-C in HEK-293 cells. However, the difference was not statistically significant (p = 0.178). In SK-N-SH cells, no statistical difference in relative fluorescence intensity was found between the recombinant vectors T-del-G-G-C-G-G and T-T-T-G-C-G-C (p = 0.956).
Graph: Fig. 4 Relative fluorescence intensity of two different recombinant haplotypes in HEK-293 and SK-N-SH cells. a and b represent the relative fluorescence intensity (LUC/TK values) of two haplotypes in HEK-293 cells and SK-N-SH cells, respectively. Del-G-G represents the haplotype T-del-G-G-C-G-G; T-T-C represents the haplotype T-insT-T-G-C-C. There was no significant difference in relative fluorescence intensities between the T-del-G-G-C-G-G and T-insT-T-G-C-G-C haplotypes in HEK-293 (p = 0.178) or SK-N-SH cells (p = 0.959)
In the present study, we examined the association between the GRIN1 gene and the risk of schizophrenia in a northern Chinese Han population. Using Sanger DNA sequencing, we detected seven SNPs, including rs112421622 (− 2019 T/C), rs138961287 (− 1962--1961insT), rs117783907 (−1945G/T), rs181682830 (−1934G/A), rs7032504 (-1742C/T), rs144123109 (−1140G/A) and rs11146020 (−855G/C). Novel mutations were not detected.
Both genotype and allele distribution of rs117783907 (−1945G/T) were significantly different between the case and control groups (p < 0.0083). The genotype frequencies of rs138961287 (− 1962--1961insT) and rs11146020 (−855G/C) were statistically different between the case and control groups (p < 0.05), indicating that rs138961287 (− 1962--1961insT), rs117783907 (−1945G/T) and rs11146020 (−855G/C) are related to schizophrenia. Another association study in a northern Chinese Han population reported that the C allele frequency of rs11146020 reduced the risk of schizophrenia [[
The risk of developing psychosis increases with the accumulation of many genetic risk variants and exposure to multiple adverse environmental factors [[
There have been no studies involving the two SNPs in linkage disequilibrium rs138961287 (− 1962--1961insT) and rs117783907 (−1945G/T). The frequency of the T allele of rs117783907 (−1945G/T) in the case group was significantly lower than in the control group, indicating that it could be a protective factor in individuals of northern Han Chinese descent with schizophrenia.
According to the GTEx database, the GRIN1 gene was highly expressed in brain tissues compared to other tissues, suggesting that GRIN1 may play an important role in the CNS. Pranita et al. [[
We defined two haplotypes (frequencies > 0.5) in the 5′ promoter region of the GRIN1 gene. Haplotype T-del-G-G-C-G-G was statistically associated with increased risk of schizophrenia. Transcription factors regulate gene expression by interacting with cis-regulatory elements. Rice et al. [[
There were several limitations in this study. First, in addition to the seven SNPs, another polymorphism (Fig. 1), rs1003711879 (− 289--287delGCC), was also detected. Unfortunately, due to the relatively small sample size, rs1003711879 (− 289 - -287delGCC) could not be included in the genetic association study because the frequency did not reach 1%. Second, only HEK-293 and SK-N-SH cell lines were used for functional experiments, and use of additional related cell lines may provide more information.
Using Sanger DNA sequencing, we illustrated that rs11146020, rs138961287, and rs117783907 in the promoter region of the GRIN1 gene are associated with schizophrenia in a northern Chinese Han population. Haplotype T-del-G-G-C-G-G might significantly increase the risk of schizophrenia, while T-insT-T-G-C-G-C is likely not related to disease risk. However, the dual luciferase reporter assay showed that neither of the haplotypes affected luciferase expression. Future efforts will be needed to ascertain the role of GRIN1 in the etiology of schizophrenia.
YPL, XCZ, and YL designed the study. YPL performed the assay and drafted the manuscript. JXX, JFX, and XX were involved in the sample collection. MD performed statistical analysis. JY and BJW revised the manuscript. All authors read and approved the final manuscript.
Written informed consent was obtained from all subjects and/or patient guarantors. The study was approved by the Ethics Committee of China Medical University.
Not applicable.
The authors declare that they have no competing interests.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Graph: Genotype and allele distribution of SNPs in the GRIN1 gene (significance threshold = 0.0083). a Frequency is shown in brackets (%); bP value shown in bold reaches a significant level (P < 0.0083); the genotype and allele frequency distribution of -1945G/T and the genotype frequency of -855G/C and − 1962 - -1961insT were significantly different between the case and control groups. (DOC 77 kb)
Graph: Haplotypes formed by the seven SNPs in GRIN1 and disease risk (significance level = 0.025). Del-G-G represents the haplotype T-del-G-G-C-G-G, T-T-C represents the haplotype T-insT-T-G-C-C.The frequency distribution of haplotype T-del-G-G-C-G-G was significantly different between the case group and the control group, with p values of 0.005. Specifically, the frequency of haplotype T-del-G-G-C-G-G in the case group (77.8%) was much higher than in the control group (70.9%), increasing the disease risk (OR = 1.442, 95% CI: 1.116–1.862). Haplotype T-insT-T-G-C-G-C was not related to schizophrenia (XLSX 12 kb)
We would like to express our gratitude to Professor Hao Pang for his theoretical guidance.
This work was supported by the National Natural Science Foundation of China (No. 81601653). The funders had no role in the design of the study nor in the collection, analysis, and interpretation of data or in writing the manuscript.
Raw data of the study will be available upon request after publication.
By Yong-ping Liu; Mei Ding; Xi-cen Zhang; Yi Liu; Jin-feng Xuan; Jia-xin Xing; Xi Xia; Jun Yao and Bao-jie Wang
Reported by Author; Author; Author; Author; Author; Author; Author; Author; Author