E-selectin gene in essential hypertension: a case-control study.

Abstract: Background: Hypertension is associated with endothelial cell dysfunction. E‐selectin, an endothelial cell adhesion molecule, is specific for endothelial cell activation. Polymorphism in E‐selectin gene has recently been identified among which Leu554Phe E‐selectin gene polymorphism is least investigated in essential hypertension. This study reports the association of E‐selectin gene Leu554Phe polymorphism and the expression of E‐selectin gene in patients with essential hypertension. Materials and methods: We analysed the Leu554Phe polymorphism and expression of E‐selectin gene in 250 patients with essential hypertension and 250 normal healthy controls. Genotyping of Leu554Phe polymorphism was performed by polymerase chain reaction‐restriction fragment length polymorphism (PCR‐RFLP), and the expression of E‐selectin gene at mRNA and protein levels were carried out by real‐time PCR and Western blot, respectively. Results: A significant association of E‐selectin genotypes (CT + TT) with essential hypertension (P < .0001, Odds ratio = 2.2 [1.58‐3.24] at 95% CI) was observed. The expression of mRNA for E‐selectin gene in patients with essential hypertension was ~12‐fold higher as compared to control. We observed an elevated level of E‐selectin protein expression (up to 1.9 times) in patients as compared to controls. Conclusions: A significant association of E‐selectin (Leu554Phe) gene and increased expression of E‐selectin gene at mRNA and protein levels in patients might be related to the genetic predisposition to develop essential hypertension.

E‐selectin gene; essential hypertension; gene expression; single nucleotide polymorphism

Essential hypertension is a major health problem in developed as well as developing countries.[1] Hypertension is associated with endothelial cell dysfunction resulting in impaired endothelial‐dependent vasodilation, endothelial cell activation and damage.[2] [3] [4] [5] E‐selectin, a surface glycoprotein, is a major endothelial cell adhesion molecule that regulates binding and extravasation of leucocytes from the bloodstream to sites of inflammation. E‐selectin has been associated with inflammation due to its high expression in endothelium.[6] Consequently, high expression levels of E‐selectin on tumour‐associated vasculature have been observed in breast cancer, lung cancer as well as prostate cancer.[7] [8] [9] E‐selectin is in close proximity to vascular smooth muscle cells and are constantly subjected to blood flow‐induced shear stress.[10] Studies show that several genetic polymorphisms are related to essential hypertension, and genetic factors may account for 30% to 50% of the reasons for the variability in blood pressure.[11] Mutations in cell adhesion molecules, including E‐selectin and their association with cardiovascular diseases, have recently been investigated. The E‐selectin gene is rapidly expressed by endothelial cells in response to pro‐inflammatory cytokines. Experiments using double‐knockout mice suggest that E‐selectin plays an important role in atherosclerotic lesion development[12] and polymorphisms in genes that encode adhesion molecules may be associated with a high risk of severe atherosclerosis.[13] [14] Three single nucleotide polymorphisms in E‐selectin gene have been identified and reported to be associated with cardiovascular disease (CVD) or CVD risk factors. These polymorphisms are Ser128Arg (an A‐to‐C transversion in exon 4 resulting in a serine to arginine substitution at codon 128),[15] a G‐to‐T polymorphism (G98T) in the untranslated region of exon 2[16] and L554F (a C‐to‐T transversion in exon 11 resulting in a leucine to phenylalanine substitution at codon 554).[17] [18] In a previous study, we have demonstrated an impairment of the normal homeostasis of nitric oxide and cell adhesion molecules (E‐selectin and sVCAM‐1) in essential hypertension,[19] and the association of another variant of E‐selectin gene, that is Ser128Arg with essential hypertension.[20] Previous studies have been carried out to determine the role of Ser128Arg and Leu554Phe polymorphisms of E‐selectin gene in case of familial cholesterolemia in Greek population[21] and their linkage disequilibrium in CVD in Chinese, French and Spanish population.[22] Moreover, recent studies in a German population showed possible associations between the Ser128Arg and Leu554Phe variations of the E‐selectin gene and severe atherosclerosis, hypertension and cerebrovascular diseases,[18] [19] [20] [23] and their role in essential hypertension is still unknown. The possible association between mutation at Leu554Phe E‐selectin and modulation of expression of E‐selectin gene needs to be explored in essential hypertension. In this study, we report the association of Leu554Phe E‐selectin gene polymorphism in patients with essential hypertension. The study has been extended to determine the differential expression of E‐selectin gene in patients as compared to controls.

Sample size (250 patients and 250 controls) is adequate for this study determined using standard statistical method in case‐control group, at the significance level of 0.05 at power 80% on the basis of prevalence of minor alleles referred from previous studies.[20] [24] All the patients and controls were recruited for a period of 3 years (2013‐2016) for the study. Patients were identified and randomly selected from outpatient department clinics of hypertension and had a scheduled appointment with the cardiologist who provided their usual source of primary care at Department of Cardiology, All India Institute of Medical Sciences, New Delhi. These patients were residents of North India for at least three generations. This study complied with the 1964 Declaration of Helsinki and its later amendments. An approval of ethics committee of All India Institute of Medical Sciences, New Delhi, was obtained (IEC/NP‐115/2010), and informed consents were obtained from the recruited study subjects prior to study.

Blood pressure measurements were taken according to Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC‐VII) criteria. Patient had been seated on a chair with their feet on the floor, and their arms supported at heart level for 10 minutes. The definition of essential hypertension is as follows: 140 ≤ SBP ≤ 179 mm Hg, 90 ≤ DBP ≤ 109 mm Hg; healthy controls SBP < 130 mm Hg and DBP < 85 mm Hg. All hypertensive patients were diagnosed as having essential hypertension and not receiving any antihypertensive therapy. Patients were not suffering from any infectious disease, inflammatory disease, immunological disorder, secondary hypertension, diabetes and renal disorder. All the study subjects were interviewed using a standard questionnaire with regard to their age, education, lifestyle, food intake, smoking habits and alcohol consumption. Participants who smoked at least one cigarette per day at the time of the recruitment for this study were classified as smokers. For heavy smokers, daily numbers of cigarettes smoked were greater than or equal to 15 cigarettes per day.[25] None of the subjects recruited for this study were under treatment with any drug capable of modifying the inflammatory state such as lipid‐lowering drugs, anti‐inflammatory drugs, vitamin or antioxidant supplements.

Fasting (12 hours) venous blood samples (5 mL) were obtained from all subjects in an ethylenediaminetetraacetic acid vial. Genomic DNA was isolated from whole blood using the Flexigene DNA kit (QIAGEN Inc, Valencia, CA, USA) according to the manufacturer's instructions.

Genotyping of the polymorphism Leu554Phe (C1839T) of E‐selectin gene (rs5355) was identified using polymerase chain reaction‐restriction fragment length polymorphism techniques. The primers were designed using Generunner version 3.05 software (Hastings Software Inc., Hastings, NY, USA) based on gene bank sequence (NCBI Reference Sequence: NC_000001.10). The reliability of our genotyping was confirmed by direct sequencing of amplified DNA from randomly selected samples (20%) in both the study subjects, with no difference observed in results between the two methods. To estimate the assay error rate, 20% of the sample were randomly selected and included as duplicates in genotyping run. PCR amplification conditions were standardized for the above‐mentioned polymorphisms.

For gene polymorphism study, the sequence of the primers used was forward primer 5′‐CTCCCTCCTGACATTAGC‐3′ and that of reverse primer was 5′‐GAAACACTTCCCACACTGA‐3′. The amplified PCR product of 236 bp was digested with BsaXI restriction enzyme. The digestion product was separated on 2.5% agarose gel containing ethidium bromide and visualized directly by UV illumination. Digestion of the PCR products yielded bands of 197 and 39 bp in homozygous wild‐type (CC), 236 bp in homozygous rare (TT), and the three bands (236, 197, 39 bp) in the heterozygous (CT) genotypes.

Total RNA was isolated using RNA isolation kit QIAGEN Inc in blood samples from the study subjects.

RNA obtained was reverse‐transcribed using the Fermentas first‐strand cDNA kit (Reverse Transcription). Real‐time quantitative PCR analysis for E‐selectin gene was performed using the following primers: Forward primer: 5′‐CAACACCCATCACCACTTCAATAG‐3′ and reverse primer: 5′‐CAGCGAGCAAGGGAGAGTTAGA‐3′. Housekeeping genes 18S rRNA was used as an internal control and the primer pair was as follows: forward primer 5′‐GTGGTGTTGAGGAAAGCAGACA‐3′ and reverse primer 5′‐TGATCACACGTTCCACCTCATC‐3′ with SYBR green PCR Core reagents.[26] [27] All assays were performed in triplicate. The delta‐delta‐CT equation was used to compare the expression of E‐selectin gene between patients and controls in terms of fold difference.[26] [27] Melting curve analysis showed a single peak product of real‐time PCR either for E‐selectin or for housekeeping gene which confirmed the specificity of the quantitative PCR assay.

Total protein was isolated from plasma by acetone precipitation method and estimated using bicinchoninic acid protein estimation kit (Bangalore Genei, Bengaluru, India). The human E‐selectin protein (115 kDa) expression was performed by Western blot technique using E‐selectin primary antibody (1:500 dilution; sc‐14011; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and horseradish peroxidase‐conjugated secondary antibody (1:5000 dilutions; sc‐2357, Santa Cruz Biotechnology, Inc.) according to described procedures,[26] [27] with slight modifications. The protein expression was compared by the average ratio of integrated densitometric value for protein bands of E‐selectin and β‐actin in the study subjects. Protein expression analysis was carried out in randomly selected patients (n = 50) and controls (n = 50) of the study groups.

The sample size was calculated using PS‐Power (Dept. of Biostatistics, Vanderbilt University School of Medicine, Nashville, TN, USA) and sample size calculation version 3.0 software, with an α error of 5% and a power 80% and was found to be adequate in both the study subjects. Statistical analyses were performed with commercial software (STATA, version 12.1, StataCorp LLC, College Station, TX, USA). Normally distributed data are presented as mean ± SD. Chi‐square goodness of fit was used to verify the agreement of observed genotype frequencies with those expected (Hardy‐Weinberg equilibrium). The analysis of variance was used to calculate the difference between genotype groups using Bonferroni's method for multiple comparisons between genotype classes. An odds ratio at 95% confidence intervals (CI) was calculated as an index of the association of the genes with essential hypertension.

The baseline characteristics of patients with essential hypertension (N = 250) and normal healthy controls (N = 250) are listed in Table . No statistically significant differences in the clinical characteristics were observed between patients and controls. There was nonsignificant difference between number of male and female in the study subjects. Systolic blood pressures (SBP) and diastolic blood pressures (DBP) in patients were significantly higher than that of controls. The numbers of alcohol users and smokers for hypertension were slightly higher in patients as compared to controls.

Baseline characteristics of the study subjects

• 2 BMI, body mass index; CRP, C‐reactive protein; HDL, high‐density lipoprotein; LDL, low‐density lipoprotein.
• 3 The patient group was compared with the control group with t test of significance or by chi‐square test.
• 4 P < .05 is considered to be significant.

The genotypes and alleles of E‐selectin (Leu554Phe) gene polymorphism were in accordance with the Hardy‐Weinberg equilibrium in both the patient (χ2 = 0.4, P > .05) and control groups (χ2 = 2.74, P > .05). The genotypic pattern obtained for controls was CC > CT > TT, while CT genotype was more frequent in the patient group as compared to CC and TT genotypes. The observed allele frequencies for C allele and T allele were 0.81 and 0.19 in the control group and 0.67 and 0.33 in the patient group, respectively. We observed a significant association in the E‐selectin genotypes (CT + TT) with essential hypertension (P < .0001, Odds ratio = 2.2 [1.58‐3.24] at 95% CI). The adjusted odds ratio for C vs T allele frequencies was found to be 2.1 (1.57‐2.80) [P < .0001 at 95% CI] (Table ).

Genotype and allele frequencies of Leu554Phe variant of the E‐selectin gene

• 5 The patient group was compared with control group with chi‐square (χ2) test at one degree of freedom with odds ratio adjusted for age and sex in both genotypes and alleles.
• 6 P < .05 is considered to be significant.

We observed a significant (P = .0001) intergenotypic variation in the SBP in patients with CC, CT and TT genotypes. Statistically significant results were found between the genotypes and SBP when compared with CC vs CT (P = .0003), CC vs TT (P = .0001) and CT vs TT (P = .004), respectively. The intergenotypic variation in the DBP was not significantly (P = .16) different in patients with CC, CT and TT genotypes (Table ).

Intergenotypic (Leu554Phe variant of the E‐selectin gene) variations in systolic and diastolic blood pressure in patients with essential hypertension

• 7 SBP, systolic blood pressure; DBP, diastolic blood pressure was compared with respect to genotypes with t test of significance at one degree of freedom adjusted for age and sex.
• 8 Analysis of variance using Bonferroni's method for multiple comparisons between genotype classes.
• 9 P < .05 is considered to be significant.

We observed a statistically significant difference (P < .001) in the average delta‐CT value between the patient (3.9 ± 1.3) and control groups (7.52 ± 1.5). The delta‐delta‐CT value for patients was found to be −3.6. The relative expression of mRNA for E‐selectin gene to 18S rRNA in patients with essential hypertension was ~12‐fold higher as compared to control (Table ).

Fold change expression in quantitative PCR in Leu554Phe variant of the E‐selectin gene

• 10 CT, threshold cycle; data are means ± SD.
• 11 18S rRNA gene expression of the same samples was used for calculations.
• 12 P = .0001.

We observed a significant (P = .0001) intergenotypic variation in gene expression (delta‐CT values) in patients with CC, CT and TT genotypes. There were statistically significant results found between the genotypes and average delta‐CT value when compared with CC vs CT (P = .001), CC vs TT (P = .001) and CC vs CT + TT (P = .001), respectively. The intergenotypic variation in gene expression (delta‐CT values) was not significantly (P = .60) differed in controls with CC, CT and TT genotypes (Table ).

Intergenotypic (Leu554Phe variant of the E‐selectin gene) variations in gene expression (delta‐CT values) in study subjects

• 13 Patients and controls were compared with respect to genotypes with t test of significance at one degree of freedom adjusted for age and sex.
• 14 Analysis of variance using Bonferroni's method for comparison of intergenotypic levels of delta‐CT values in patient group.
• 15 P < .05 is considered to be significant.

Figure  shows representative Western blots of plasma E‐selectin protein in patients with essential hypertension and controls. The expression of E‐selectin protein was significantly 1.9 times higher in the patient (1.37 ± 0.18) group as compared to controls (0.72 ± 0.12) (P = .0001). Expression of β‐actin protein was used as an internal control for the Western blot analysis.

E‐selectin is not detected in inactivated endothelial cells but is rapidly synthesized in response to certain cytokines and other pro‐inflammatory stimuli, making an activated endothelial marker.[28] The increase in circulating E‐selectin levels in hypertension might be reflecting endothelial cell damage caused by hypertension, or alternatively, the E‐selectin gene could by itself be a determinant of blood pressure.[29] [30] E‐selectin and its participation in the endothelial dysfunction have suggested its important role in hypertension.[31] Studies suggested that endothelial activation associated with oxidative stress is an important factor in the development of atherosclerosis[32] and hypertension,[33] [34] leading to the progression of the CVDs.

Epidemiological studies have shown that E‐selectin (Leu554Phe) gene polymorphism may be associated with essential hypertension, but the results are conflicting in different ethnic populations. Several findings have indicated that polymorphisms in genes that encode adhesion molecules may be associated with high risk of essential hypertension.[18] [19] Few studies are reported about the relation between E‐selectin Leu554Phe (C1839T) polymorphism and essential hypertension. Marteau et al studied the relationship between C1839T polymorphism and blood pressure changes in a Stanislas cohort and found no gene‐disease association.[18] Li et al found a negative relationship between E‐selectin C1839T polymorphism and essential hypertension, but the result was not statistically significant.[35] Similar results were also reported by Wang et al investigating the relationship between E‐selectin gene polymorphism and essential hypertension in Han, Kazakh and Uygur population.[31] In a meta‐analysis conducted by Cai et al in Asian populations, the T allele of the above‐mentioned gene polymorphism is not a susceptibility factor for the disease.[24] However, the minor allele frequency (C allele) reported in Mexican population was greater than 5% which allows detecting the variant and making reliable group comparisons.[36] Together, this data support the importance of E‐selectin in hypertension and further investigation of genetic variability among Asian Indian populations. The present study confirms the significant association between the E‐selectin Leu554Phe gene polymorphism and essential hypertension. We found that the patients with T allele were significantly higher than that of normal control. The risk of essential hypertension associated with T allele was approximately 2 times higher odds to develop hypertension (2.1 [1.57‐2.80] at 95% CI, P < .0001), which indicates that T allele may be a risk factor for essential hypertension in northern India of Asian region. In multivariate logistic regression analysis, no statistically significant association between the genotypes and baseline parameters of essential hypertension was found (data not shown), except in case of SBP in patients. We also observed intergenotypic variations in the mean SBP in patients which once again indicates that the subjects having TT genotypes are more prone to develop essential hypertension.

In the present study, analysis of the expression of the E‐selectin also showed a significant difference in the average delta‐CT value of E‐selectin gene expression between patients and controls. We found approximately 12‐fold upregulation of E‐selectin gene expression in patients with essential hypertension as compared to controls.

Importantly, the expression of E‐selectin gene was higher in patients with TT genotypes as compared to TC and CC. However, this trend was not observed in the control group. This further strengthens the fact that increased expression of E‐selectin is associated with essential hypertension. We also observed a significant increase (P = .0001) in the expression of E‐selectin gene at protein level in a meaningful number of patients with essential hypertension as compared to similar age‐ and sex‐matched controls. The E‐selectin protein levels were increased up to 1.9 times in patients compared to the control group which are well supported by the studies indicating the role of circulating E‐selectin levels in the regulation of blood pressure.[19] [37]

Our study shows a significant association of E‐selectin (Leu554Phe) gene with essential hypertension, which is a major risk factor for coronary artery diseases and strokes. An increased expression of E‐selectin gene at mRNA and protein levels was also observed in patients with essential hypertension. Our observations are exploratory; an extended sample‐sized patient follow‐up study is warranted to ascertain E‐selectin gene expression as independent risk factor, and it can serve as prognostic marker for essential hypertension. The present study would be a lead in the development of new approaches for predicting the progression of hypertension and novel therapeutic strategies for its effective management.

No assistance in the preparation of this article is to be declared.

The authors have no potential conflict of interests to declare.

No relevant financial or other relationships to disclose.

KS conceived and designed the experiments and contributed reagents/materials/analysis tools. KS and SC performed the experiments. KS, SC, DS, RN and JB analysed the data. KS, SC, DS and RN wrote the manuscript. RN performed screening and recruitment of study subjects. JB performed sample collection.

PHOTO (COLOR): E‐selectin protein expression in study subjects. Figure 1 represents the Western blots of E‐selectin and β‐actin protein in control group and patient group, respectively